|
nasdaq:bdsi
|
BioDelivery Sciences
|
Feb 4th, 2014 12:00AM
|
Jan 11th, 2007 12:00AM
|
https://www.uspto.gov?id=US08642073-20140204
|
Encochleation methods, cochleates and methods of use
|
Disclosed are novel methods for making cochleates and cochleate compositions that include introducing a cargo moiety to a liposome in the presence of a solvent. Also disclosed are cochleates and cochleate compositions that include an aggregation inhibitor, and optionally, a cargo moiety. Additionally, anhydrous cochleates that include a protonized cargo moiety, a divalent metal cation and a negatively charge lipid are disclosed. Methods of using the cochleate compositions of the invention, including methods of administration, are also disclosed.
|
8642073
|
1. A cochleate composition comprising:
Amphotericin B;
a plurality of cochleates comprising soy phosphatidyl serine; and
0.2%-0.4% (w/w) methylcellulose; and
wherein the weight ratio of soy phosphatidyl serine to Amphotericin B is about 5:1.
2. The composition of claim 1, wherein the plurality of cochleates has a mean diameter of less than about 600 nm.
3. The composition of claim 1, wherein the plurality of cochleates has a mean diameter of less than about 500 nm.
4. The composition of claim 1, wherein the size distribution of the plurality of cochleates is less than about 700 nm.
5. The composition of claim 1, wherein the size distribution of the plurality of cochleates is less than about 550 nm.
6. The composition of claim 1, wherein the composition is in the form of a nasal spray.
7. A pharmaceutical composition comprising a therapeutically effective amount of the cochleate composition of claim 1 and a pharmaceutically acceptable carrier.
8. A method of treating a subject that can benefit from the administration of Amphotericin B, comprising the step of:
administering the pharmaceutical composition of claim 7 to said subject, such that the subject is benefited.
9. The method of treatment according to claim 8, wherein the administration is by a mucosal or a systemic route.
10. The method of treatment according to claim 8, wherein the administration is a mucosal route selected from the group consisting of oral, intranasal, intraocular, intrarectal, intravaginal, topical, buccal and intrapulmonary.
11. The method of treatment according to claim 8, wherein the administration is intranasal.
12. The method of treatment according to claim 11, wherein the pharmaceutical composition is delivered in a form selected from the group consisting of a spray, a nebulae, a mist, an atomized vapor, an irrigant, an aerosol, a wash, and an inhalant.
13. The method of claim 8, wherein the pharmaceutical composition is used to treat rhinosinusitis.
14. The method of treatment according to claim 8, wherein the administration is by a systemic route selected from the group consisting of intravenous, intramuscular, intrathecal, subcutaneous, transdermal and intradermal.
15. The method of claim 8, Amphotericin B is administered to treat-parasitic disorders.
16. The method of claim 8, wherein the pharmaceutical composition is administered to treat asthma.
17. The method of claim 8, wherein the pharmaceutical composition is administered to treat at least one disorder selected from the group of consisting of asthma, chronic rhinosinusitis, allergic fungal sinusitis, sinus mycetoma, non-invasive fungus induced mucositis, and non-invasive fungus induced intestinal mucositis.
|
17
|
RELATED APPLICATIONS
This application is a continuation of U.S. Ser. No. 10/822,230 filed Apr. 9, 2004, which claims the benefit of and priority to U.S. Provisional Application No. 60/461,483 filed Apr. 9, 2003; U.S. Provisional Application Ser. No. 60/463,076, filed Apr. 15, 2003; U.S. Provisional Application Ser. No. 60/502,557, filed Sep. 11, 2003; U.S. Provisional Application Ser. No. 60/537,252, filed Jan. 15, 2004; U.S. Provisional Application No. 60/499,247 filed Aug. 28, 2003; U.S. Provisional Application No. 60/532,755, filed Dec. 24, 2003; and U.S. Provisional Application No. 60/556,192, filed Mar. 24, 2004. The entire contents of each of the aforementioned applications are hereby expressly incorporated herein by reference in their entireties.
GOVERNMENT SUPPORT
Portions of the subject matter disclosed herein were supported by Federal Grant No. NIAID SBIR PI R43 AI46040-01, awarded by the National Institutes of Health. The U.S. Government may have certain rights in the invention.
TECHNICAL FIELD
The invention generally relates to cochleate delivery vehicles. More specifically, the invention relates to novel methods of making and using cochleates employing a solvent to encochleate a cargo moiety, to cochleates including one or more aggregation inhibitors, and to cochleates including a protonized cargo moiety, divalent cation and negatively charged lipid.
BACKGROUND
The advantages of cochleates are numerous. For example, cochleates are more stable than aqueous structures such as liposomes, they can be stored lyophilized which provides the potential to be stored for long periods of time at room temperatures, they maintain their structure even after lyophilization (whereas liposome structures are destroyed by lyophilization), and they are non-toxic.
Cochleate structures have been prepared first by D. Papahadjopoulos as an intermediate in the preparation of large unilamellar vesicles. U.S. Pat. No. 4,078,052. Methods of making and using cochleates to deliver a variety of molecules have been disclosed, e.g., in U.S. Pat. Nos. 5,994,318 and 6,153,217.
In these methods, prior to precipitation of the cochleates, the material to be encochleated is introduced into liposomes by solubilization of the lipid and material in solvent, removal of the solvent to form a dry lipid film, then by hydration of the lipid and components to be encochleated. Alternatively, material and lipid may be solublized in detergent which may be removed by dialysis or other methods. These steps are time consuming, represent added expense in manufacturing and product costs, and can in some instances affect the activity and/or stability of the encochleated material.
Additionally, cochleates are highly susceptible to aggregation, and thus particle size and particle size distribution can be highly variable and unstable after preparation and removal from the two-phase polymer system. The ability of drugs to be administered via the oral route depends on several factors. The drug typically must be sufficiently soluble in the gastrointestinal fluids in order for the drug to be transported across biological membranes for an active transport mechanism or have a sufficiently small particle size, such that it can be absorbed through the Peyer's Patches in the small intestine and through the lymphatic system. Particle size is an important parameter when oral delivery is to be achieved (see Couvreur P. et al, Adv. Drug Delivery Reviews 10:141-162, 1993). Thus, it would be advantageous to be able to control and stabilize the particle size and particle size distribution of encochleated materials.
There also exists a need for delivery vehicles that can safely and effectively deliver cargo moieties that are poorly absorbed by the body (e.g., weakly basic drugs). For example, aminoglycopeptides (e.g., vancomycin), are poorly absorbed through the GI tract and are difficult to deliver to cells harboring bacteria. Accordingly, in order to administer an effective amount of drug against a bacterial infection, large amounts of drug are ingested to not only account for poor absorption through the GI tract, but also poor delivery to the site of infection. Consequently, a toxic level of drug can accumulate in the GI tract (e.g., in the kidneys) or the blood stream and can lead to serious illness, such as erythematous or urticarial reactions, flushing, tachycardia, and hypotension. Aminoglycosides (e.g., streptomycin and tobramycin) are similarly problematic because of the risk of nephrotoxicity and ototoxicity due to poor absorption, which can lead to acute, renal, vestibular and auditory toxicity. While these drugs can be delivered intravenously to bypass the issue of poor GI tract absorption, uptake by the cells is still problematic. That is, even at high concentrations, aminoglycopeptides and aminoglycosides can not penetrate the cell membrane in order to contact the bacteria. Additionally, echinocandins (e.g., caspofungin), a new, less toxic class of antifungal drugs, still have unwanted side effects and poor oral bioavailability. As such, they are generally administered intravenously.
The present invention addresses each of these drawbacks.
SUMMARY OF THE INVENTION
The present invention provides novel methods of forming cochleates, which methods can be efficiently and easily scaled up. Additionally, the present invention provides an anhydrous cochleate including a protonized cargo moiety, e.g., an aminoglycoside, and methods for making and administering the same. The present invention also provides a cochleate composition which includes an aggregation inhibitor, and methods for making an administering the same.
In one aspect, the present invention provides a method for forming a cargo moiety-cochleate, which includes introducing a cargo moiety to a liposome in the presence of a solvent such that the cargo moiety associates with the liposome and precipitating the liposome to form a cargo moiety-cochleate. The cargo moiety can be any cargo moiety described herein, including protonized cargo moieties. In certain embodiments, the cargo moiety is hydrophobic, hydrophilic, hydrosoluble or amphipathic. In other embodiments, the cargo moiety is an antifungal agent.
In preferred embodiments, the solvent is a water miscible solvent, more preferably the solvent is dimethylsulfoxide (DMSO), a methylpyrrolidone, N-methylpyrrolidone (NMP), acetonitrile, alcohol, ethanol, dimethylformamide (DMF), ethanol (EtOH), tetrahydrofuran (THF), or combinations thereof. In certain embodiments, the method can further involve introducing a solution of the solvent and the cargo moiety to an aqueous liposomal suspension. In preferred embodiments, the solution is introduced dropwise, by continuous flow addition, or in a bolus. Additionally or alternatively, the method can further involve introducing the cargo moiety to a liposomal suspension comprising the solvent. In preferred embodiments, the cargo moiety is introduced as a powder or a liquid. In other embodiments, an antioxidant can be introduced to the liposomal suspension.
In yet other embodiments, the liposomal suspension comprises a plurality of unilamellar and multilamellar liposomes. In preferred embodiments, the method additionally includes the step of filtering or mechanically extruding through a small aperture the liposomal suspension such that a majority of the liposomes are unilamellar.
In still other embodiments, the method further involves precipitating the liposome with a multivalent cation to form a cargo moiety-cochleate. In yet other embodiments, the solvent can be removed from the liposome by dialysis and/or washing.
In some embodiments, the ratio of the lipid to the cargo moiety is between about 0.5:1 and about 20:1. In other embodiments, the ratio of the lipid to the cargo moiety is between about 20:1 and about 20,000:1.
In other embodiments, the method also includes introducing an aggregation inhibitor to the liposomes or the cochleates. The aggregation inhibitor can be any aggregation inhibitor described herein.
In another aspect, the instant invention provides composition which includes one or more cochleates made by any one of the methods described herein.
In yet another aspect, the instant invention provides a composition including an anhydrous cochleate. In one embodiment, the anhydrous cochleate includes a negatively charged lipid, a protonized cargo moiety, and a divalent metal cation. In some preferred embodiments, the protonized cargo moiety is water soluble. In other preferred embodiments, the protonized cargo moiety is a protonized weakly basic cargo moiety. In still other preferred embodiments, the protonized cargo moiety is a multivalent cation.
In particularly preferred embodiments, the protonized cargo moiety is a protonized peptide, a protonized protein, a protonized nucleotide, including a protonized DNA, a protonized RNA, a protonized morpholino, a protonized siRNA molecule, a protonized ribozyme, a protonized antisense molecule, or a protonized plasmid, an aminoglycoconjugate, such as a protonized aminoglycoside or a protonized aminoglycopeptide, including protonized vancomycin, teicoplanin, bleomycin, peptidolglycan, ristocetin, sialoglycoproteins, orienticin, avaporcin, helevecardin, galacardin, actinoidin, gentamycin, netilmicin, tobramycin, amikacin, kanamycin A, kanamycin B, neomycin, paromomycin, neamine, streptomycin, dihydrostreptomycin, apramycin, ribostamycin, spectinomycin, or a protonized echinocandin, including protonized caspofungin, echinocandin B, aculeacin A, micafungin, anidulafungin, cilofungin, pneumocandin and any combinations thereof.
In some embodiments, the ratio of protonized cargo moiety to lipid is about 2:1 by weight. In other embodiments, the ratio of protonized cargo moiety to lipid is between about 4:1 and about 10:1 by weight. In yet other embodiments, the composition can additionally include a second protonized cargo moiety or a cargo moiety. The cargo moiety nay be any of the cargo moieties discussed herein. In a preferred embodiment, the cargo moiety is a nutrient. In a particularly preferred embodiment, the nutrient is Vitamin E. In other preferred embodiments, the divalent metal cation is barium or calcium.
In some embodiments, the composition may include an aggregation inhibitor. Any of the aggregation inhibitors discussed herein may be used.
In some embodiments, the lipid may include a phospholipid. In preferred embodiments, the phospholipid is a dioleoylphosphatidylserine (DOPS) and/or a phosphatidylserine (PS).
In still other embodiments, the present invention provides a method for forming an anhydrous cochleate which includes the step of contacting a negatively charged lipid, a protonized cargo moiety and a divalent metal cation, such that a cochleate is formed.
In some preferred embodiments, the method includes the step of acidifying a cargo moiety to form a protonized cargo moiety. In other preferred embodiments, the method includes the step of adjusting the pH of a solution of the cochleate to maintain a protonized cargo moiety.
In yet other embodiments, the cochleate further comprises a second protonized cargo moiety. In still other embodiments, the divalent metal cation is barium or calcium.
In still other embodiments, an aggregation inhibitor can be introduced to the cochleate. In preferred embodiments, the aggregation inhibitor is introduced to the cochleate before and after the cochleate is formed. In particularly preferred embodiments, the aggregation inhibitor comprises casein and methylcellulose, and the casein is introduced before the cochleate is formed and the methylcellulose is introduced after the cochleate is formed.
In another aspect, the present invention is directed to a cochleate which includes an aggregation inhibitor. In certain embodiments, the present invention is directed to a cochleate composition including a plurality of cochleates and an aggregation inhibitor. In some preferred embodiments, the aggregation inhibitor coats the cochleate. The cochleate composition can further include a cargo moiety, and the cargo moiety can be any of the cargo moieties discussed herein, including protonized cargo moieties. In preferred embodiments, the cochleate includes an antifungal drug. Preferred aggregation inhibitors include proteins, peptides, polysaccharides, milk or milk products, polymers, gums, waxes and/or resins. Particularly preferred aggregation-inhibitors include casein, κ-casein, milk, albumin, serum albumin, bovine serum albumin, rabbit serum albumin, methylcellulose, ethylcellulose, propylcellulose, hydroxycellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, polyvinyl pyrrolidone, carboxymethyl cellulose, carboxyethyl cellulose, pullulan, polyvinyl alcohol, sodium alginate, polyethylene glycol, polyethylene oxide, xanthan gum, tragacanth gum, guar gum, acacia gum, arabic gum, polyacrylic acid, methylmethacrylate copolymer, carboxyvinyl polymer, amylose, high amylose starch, hydroxypropylated high amylose starch, dextrin, pectin, chitin, chitosan, levan, elsinan, collagen, gelatin, zein, gluten, carrageenan, carnauba wax, shellac, latex polymers, milk protein isolate, soy protein isolate, and/or whey protein isolate. In particularly preferred embodiments, the aggregation inhibitor is casein, methylcellulose, albumin, serum albumin, bovine serum albumin and/or rabbit serum albumin.
In preferred embodiments, the plurality of cochleates has a mean diameter of less than about 600 nm. In particularly preferred embodiments, the plurality of cochleates has a mean diameter of less than about 500 nm. In other preferred embodiments, the size distribution of the plurality of cochleates is less than about 700 nm. In particularly preferred embodiments, the size distribution of the plurality of cochleates is less than about 550 nm.
In other embodiments, the cochleate further includes an antifungal drug. In preferred embodiments, the antifungal drug is Amphotericin B, miconazole nitrate, ketoconazole, itraconazole, fluconazole, griseofulvin, clotrimazole, econazole, terconazole, butoconazole, oxiconazole, sulconazole, saperconazole, voriconazole, ciclopirox olamine, haloprogin, tolnaftate, naftifine, terbinafine hydrochloride, morpholines, flucytosine, natamycin, butenafine, undecylenic acid, Whitefield's ointment, propionic acid, caprylic acid, clioquinol, nystatin, selenium sulfide, caspofungin, echinocandin B, aculeacin A, micafungin, anidulafungin, cilofungin, and/or pneumocandin. In particularly preferred embodiments, the antifungal drug is Amphotericin B and the aggregation inhibitor comprises methylcellulose. In other particularly preferred embodiments, the composition is a nasal spray.
In yet another aspect, the present invention provides a cochleate composition which includes a first plurality of cochleates with a first mean particle size and a second plurality of cochleates with a second mean particle size, wherein the second mean particle size is different from the first mean particle size. In preferred embodiments, the composition includes at least one cargo moiety. In some particularly preferred embodiments, the first plurality of cochleates and the second plurality of cochleates include the same cargo moiety. In other particularly preferred embodiments, the first plurality of cochleates contains a different cargo moiety than the second plurality of cochleates.
In another embodiment, the cochleate composition can include a third plurality of cochleates with a third mean particle size, wherein the third mean particle size is different from both the first and the second mean particle sizes. In a preferred embodiment, the third plurality of cochleates includes a cargo moiety.
In still another aspect, the present invention provides a method of making a cochleate composition including introducing an aggregation inhibitor to a cochleate composition. In some embodiments, the method includes introducing the aggregation inhibitor to a composition of cochleates. In other embodiments, the method includes introducing the aggregation inhibitor to a composition of aggregated cochleates. In still other embodiments, the method includes introducing the aggregation inhibitor to a composition of liposomes and inducing formation of the cochleate composition. In yet other embodiments, the method includes introducing the aggregation inhibitor to a solution of lipids, forming a liposomes, and inducing formation of the cochleate composition. In preferred embodiments, the aggregation inhibitor is added in an aggregation inhibitor to lipid ratio of between about 4:1 and about 0.1:1 by weight. In particularly preferred embodiments, the aggregation inhibitor is added in an aggregation inhibitor to lipid ratio of about 1:1 by weight. In other particularly preferred embodiments, the aggregation inhibitor is added in an amount suitable for modulating the resulting cochleate to the desired size range.
In yet other embodiments, the present invention includes pharmaceutical compositions including any of the cochleates or cochleate compositions discussed herein.
In still other aspects, the present invention provides methods for treating a subject that can benefit from the administration of a cargo moiety, including protonized cargo moieties, by administering cochleates or cochleate compositions such that the cargo moiety is administered to the subject and such that the subject is treated. Cochleates or cochleate compositions of the invention can be made using any of the methods described herein, including introducing a cargo moiety to a liposome in the presence of a solvent such that the cargo moiety associates with the liposome and precipitating the liposome to form a cargo moiety-cochleate. Any of the cargo moieties and protonized cargo moieties described herein can be administered in the cochleates of the present invention. In another preferred embodiment, the cochleate compositions include an aggregation inhibitor. In particularly preferred embodiments, the aggregation inhibitor is casein, methylcellulose, albumin, serum albumin, bovine serum albumin and/or rabbit serum albumin.
In a preferred embodiment, the cochleates are used for treating a bacterial infection in a host. In other preferred embodiments, the cochleates are used for treating a fungal infection in a host. In particularly preferred embodiments, the host of the bacterial infection or the fungal infection is a cell, a tissue or an organ. In other preferred embodiments, the subject can benefit from administration of a nutrient and the cargo moiety is a nutrient. Administration of cochleates can be used to treat any of the diseases or disorders described herein. In preferred embodiments, the compositions of the invention are used to treat rhinosinusitis.
Administration of cochleates can be by a mucosal route, including oral, intranasal, intraocular, intrarectally, intravaginal, topical, buccal and intrapulmonary, or by a systemic route, including intravenous, intramuscular, intrathecal, subcutaneous, transdermal and intradermal. In a preferred embodiment the administration is intranasal. In another embodiment, the cochleate composition is delivered in the form of a solid, a capsule, a cachet, a pill, a tablet, a gelcap, a crystalline substance, a lozenge, a powder, a granule, a dragee, an electuary, a pastille, a pessary, a tampon, a suppository, a patch, a gel, a paste, an ointment, a salve, a cream, a foam, a lotion, a partial liquid, an elixir, a mouth wash, a syrup, a spray, a nebulae, a mist, an atomized vapor, an irrigant, an aerosol, a tincture, a wash, an inhalant, a solution or a suspension in an aqueous or non-aqueous liquid, and an oil-in-water and/or water-in-oil liquid emulsion. In a preferred embodiment, the cochleate composition is delivered in a form of a spray, a nebulae, a mist, an atomized vapor, an irrigant, an aerosol, a wash, and/or inhalant. In a preferred embodiment, the cochleate composition includes an antifungal drug. The antifungal drug can include any of the antifungal drugs discussed herein
In yet another aspect, the present invention involves an article of manufacture which includes packaging material and a lipid contained within the packaging material, wherein the packaging material comprises a label or package insert indicating the use of the lipid for forming cochleates or cochleate compositions of the invention. In preferred embodiments, the article of manufacture can additionally include instructions or guidelines for the formation of cochleates or cochleate compositions, a solvent, a phospholipid, a cargo moiety, a protonized cargo moiety, a multivalent cation, a divalent metal cation, a control cargo moiety, a chelating agent, and/or an aggregation inhibitor. In particularly preferred embodiments, one of the instructions involves mixing a cargo moiety with a solvent and dripping it into a solution of the lipids.
DESCRIPTION OF THE DRAWINGS
FIG. 1 is two fluorescent images of Rhodamine-labeled cochleates incubated with splenocytes. These images demonstrate a transfer of lipid to the cell membrane, and indicate that a fusion event occurred between the outer layer of the cochleate and the splenocyte cell membrane.
FIG. 2 illustrates an exemplary method of the present invention, wherein drug-liposomes are obtained by addition of a hydrophobic drug in solvent, optionally with an antioxidant, to a liposomal suspension.
FIG. 3 illustrates another aspect of the invention, wherein hydrosoluble drugs are encochleated.
FIG. 4 is a series of images of an Amphotericin B formulation having a lipid to drug ratio of 1:1 at different stages in the formulation: liposomes, liposomes with AmB, cochleates, and cochleates after addition of EDTA.
FIGS. 5, 6 and 7 are each a series of images, before and after addition of EDTA, of AmB-cochleate formulations having a lipid to drug ratio of 10:1, 2:1, and 1:1 ratio, respectively.
FIG. 8 is a graph of the size distribution of the liposomes after vortexing and prior to filtration, after filtration with 0.45 μm filter, and after introducing DMSO/Amphotericin.
FIG. 9 is a graph of the size distribution of cochleate formulations having lipid to AmB ratios of 10:1, 2:1 and 1:1.
FIG. 10 is a graph of the survival data for C. albicans-infected mice untreated (control), or dosed daily for 14 days with AmB/deoxycholate, or AmB-cochleates with a lipid to drug ratio of 2:1, 3:1, 4:1, or 5:1.
FIG. 11 is a chart of the average number of C. albicans cells/gram of tissue in the liver, kidney, and lungs of C. albicans-infected mice untreated and dosed daily for 14 days with AmB/deoxycholate, or AmB-cochleates with a lipid to drug ratio of 2:1, 3:1, 4:1, or 5:1.
FIG. 12 is a graph of the number of colony forming units (CFU) for the C. albicans-infected macrophages dosed with varying concentrations of AmB-cochleates with lipid to drug ratios of 2:1, 3:1, 4:1, and 5:1.
FIG. 13 is a series of images of the 5:1 AmB cochleates (top two panels) and the cochleates after addition of EDTA (bottom two panels).
FIG. 14 is a graph of the survival data for the C. albicans-infected mice untreated or dosed daily for 14 days with AmB/deoxycholate (AmB/ID), or AmB-cochleates with a lipid to drug ratio of 5:1 (dialysis), 2:1 (dialysis), 1:1 (dialysis), or 2:1 (wash).
FIG. 15 is a chart of the average number of C. albicans cells/gram of tissue in the liver, kidney, and lungs of C. albicans-infected mice untreated (control), or dosed daily for 14 days with AmB/deoxycholate (AmB/D), or AmB-cochleates with lipid to drug ratios of 5:1 (dialysis), 2:1 (dialysis), 1:1 (dialysis), or 2:1 (washing).
FIG. 16 is a graph depicting the number of colony forming units (CFUs) for C. albicans-infected macrophages dosed with varying concentrations (0.1, 0.01 and 0.001 μl/mg) of AmB-cochleate formulations having lipid to drug ratios of 5:1 (dialysis), 2:1 (dialysis), 1:1 (dialysis), and 2:1 (washing), or AmB/deoxycholate (AmB/D).
FIG. 17 is a graph of the survival data for C. albicans-infected mice untreated (control), or dosed daily for 14 days with AmB/deoxycholate or AmB-cochleates (CAMB) in suspension or lyophilized and formulated with or without methylcellulose (MC).
FIG. 18 is a chart of the average number of C. albicans cells/gram of tissue in the liver, kidney, and lungs of C. albicans-infected mice untreated and dosed daily for 14 days with AmB/deoxycholate or AmB-cochleates (CAMB) in suspension or lyophilized and formulated with or without methylcellulose (MC).
FIG. 19 is a graph of the concentration of TY-cochleate preparations versus free TY over time.
FIG. 20 is two graphs of the concentration of each impurity over time for both the free TY and TY-cochleates studied in FIG. 21.
FIG. 21 is a graph comparing the cytotoxicity of TY-cochleates in a SKOV3 cell line.
FIG. 22 is an image of ZnTPP in solution (100% DMSO), and ZnTPP-cochleates. The ZnTPP in solution was dark purple, and the cochleate formulation was only slightly colored (pink), indicating that the ZnTPP was successfully incorporated into the cochleates, which are white/yellowish.
FIG. 23 is a series of phase contrast images (left panels) and fluorescence images (right panels), of the ZnTPP-cochleates (top panels) and ZnTPP-liposomes (bottom panels) formed. These images indicate that the ZnTPP was successfully associated with the liposomes and successfully encochleated.
FIG. 24 is a series of phase contrast images (left panels) and fluorescence images (right panels), of ZnTPP-cochleates (top panels) and ZnTPP liposomes (bottom panels) formed without the presence of solvent.
FIG. 25 is a series of images of the SKOV3 cell culture with the ZnTPP cochleates at 1 hour and 24 hours.
FIG. 26 is a series of images of the SKOV3 cell culture with the free ZnTPP (in DMSO) at 1 hour and 24 hours.
FIG. 27 is a series of images of the SKOV3 cell culture with the empty cochleates (including DOPE-pyrene lipid) at 1 hour and 24 hours.
FIG. 28 is a series of images of the SKOV3 cell culture with the ZnTPP-cochleates (including DOPE-pyrene lipid) at 1 hour and 24 hours.
FIG. 29 is a series of images illustrating the use of an exemplary kit of the invention, this is a model compound used as a control.
FIG. 30 is a schematic diagram of cochleate aggregation in the absence of an aggregation inhibitor.
FIG. 31 is a schematic diagram of an exemplary method of making cochleates of the invention by adding an aggregation inhibitor prior to cochleate formation.
FIG. 32 is a schematic diagram of an exemplary method of making cochleates of the invention by adding an aggregation inhibitor subsequent to cochleate formation.
FIG. 33A is two fluorescent images demonstrating the uptake of standard cochleates by cultured cells. FIG. 33B is two fluorescent images demonstrating the uptake of cochleates of the invention by cultured cells.
FIGS. 34A and 34B are two graphs depicting the size distribution of cochleates of the invention and standard cochleate aggregates.
FIGS. 35A-D are four fluorescent images of Rhodamine-labeled cochleates demonstrating the effect of formulating cochleates in the presence of various aggregation inhibitors: half and half (FIG. 35A), whole milk (FIG. 35B), and fat-free milk (FIG. 35C). FIG. 35D is an image of a control composition of cochleates that do not include an aggregation inhibitor.
FIGS. 36A and 36B are two fluorescent images of Rhodamine-labeled cochleates demonstrating the disaggregation of cochleates upon addition of an aggregation inhibitor.
FIG. 37A is two images comparing acetaminophen cochleates with and without aggregation inhibitor (casein). FIG. 37B is two images comparing aspirin cochleates with and without an aggregation inhibitor (casein).
FIG. 38 is a graph comparing the in vivo efficiency of coated (small) and standard (large) aspirin cochleates at different concentrations and with optional additive in reducing edema in rat paws injected with carrageenan.
FIG. 39 is a graph showing the extent of ulceration and bleeding in rats treated with free indomethacin, free aspirin, standard aspirin cochleates, and aspirin cochleates with an aggregation inhibitor versus an untreated control.
FIG. 40 is a graph indicating that empty cochleates are immunologically inert in that they have no effect on the production of NO in macrophages.
FIG. 41 is a graph comparing the efficacy of encochleated and unencochleated aspirin and acetaminophen cochleates in inhibiting NO formation.
FIG. 42 is an image of a cochleate prepared in the absence of calcium.
FIG. 43 is an image of a cochleate prepared in the presence of calcium.
FIG. 44 is an image of a cochleate prepared in the presence of calcium and subsequently treated with a molar excess of chelating agent (EDTA).
FIGS. 45A-D are images depicting vancomycin-lipid formulations. FIG. 45A depicts vanco-liposomes. FIG. 45B depicts vanco-cochleates that include an aggregation inhibitor (casein). FIG. 45C depicts vanco-cochleates without an aggregation inhibitor. FIG. 45D depicts the cochleates of FIG. 45C upon addition of a chelator (EDTA).
FIG. 46 is a graph summarizing efficacy data for free vancomycin, and vancomycin cochleates with and without casein on S. aureus at 3 hours.
FIG. 47 is a graph summarizing efficacy data for free vancomycin, and vancomycin cochleates with and without casein on S. aureus at 6 hours.
FIG. 48 are images depicting tobramycin-lipid formulations. FIG. 48A depicts tobramycin-liposomes. FIG. 48B depicts tobramycin-cochleates that include an aggregation inhibitor (casein). FIG. 48C depicts tobramycin-cochleates without an aggregation inhibitor. FIG. 48D depicts the cochleate of FIG. 48C upon addition of a chelator (EDTA).
FIG. 49 is a graph summarizing efficacy data for free tobramycin and tobramycin cochleates with and without casein on P. aeruginosa alone and cultured in macrophages at 3 hours.
FIG. 50 is a graph summarizing efficacy data for free tobramycin, and tobramycin cochleates with and without casein on P. aeruginosa alone and cultured in macrophages at 6 hours.
FIG. 51 is a series of images of 10:1 soy PS:caspofungin cochleates before (FIG. 51A) and after (FIG. 51B) addition of EDTA.
FIG. 52 is a series of images of 5:1 soy PS:caspofungin cochleates before (FIG. 52A) and after (FIG. 52B) addition of EDTA.
FIGS. 53A and 53B are two graphs demonstrating the size distribution of 10:1 soy PS:caspofungin (FIG. 53A) and 5:1 soy PS:caspofungin (FIG. 53B) cochleates.
FIG. 54 is a graph demonstrating the size distribution of 10:1 soy PS:caspofungin cochleates before and after addition of bovine serum albumin and homogenization.
FIGS. 55A and 55B are two HPLC spectra depicting the contents of opened caspofungin cochleates. In all formulations only caspofungin is evident.
FIG. 56 is a graph depicting the stability of caspofungin cochleates formulated in water, in saline and in saline with additional calcium.
FIG. 57 is a series of images depicting caspofungin cochleates at varying pH. Caspofungin cochleates appear most stable at a pH range of about 4-6.
FIG. 58 is a series of images depicting Amphotericin B cochleates with a 5:1 lipid:drug ratio containing 0.2% parabens and varying amounts of methylcellulose.
FIG. 59 is a graph depicting particle size distribution of Amphotericin B cochleates with a 5:1 lipid:drug ratio containing varying amounts of methylcellulose or 0.2% parabens.
FIG. 60 is an HPLC spectrum depicting the contents of opened Amphotericin B cochleates formed using an exemplary method of the invention. Only Amphotericin B is present in the cochleate.
FIG. 61 is a graph depicting the number of colony forming units (CFUs) for C. albicans-infected macrophages dosed with varying concentrations (5, 1, 0.1, 0.01 and 0.001 μl/mg) of AmB-cochleate formulations having lipid to drug ratios of 5:1 with and without 0.3% methylcellulose in suspension and lyophilized to form a powder.
FIG. 62 is a graph depicting the particle size distribution of amphotericin B cochleates formulated in a large batch (>5 L) with an inset of the image of the amphotericin B cochleates.
FIG. 63 is a graph depicting the particle size distribution of amphotericin B cochleates formulated in a large batch (>5 L) with additional rabbit serum albumin and passed through a homogenizer 2 times. The inset is an image of the amphotericin B cochleates after homogenization.
FIG. 64 is a graph depicting the particle size distribution of amphotericin B cochleates formulated in a large batch (>5 L) with additional rabbit serum albumin and passed through a homogenizer 7 times. The inset is an image of the amphotericin B cochleates after homogenization.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based, at least in part, on the discovery of a novel method for the formulation of cochleates and cochleate compositions. These cochleates and cochleate compositions provide all the advantages of conventional cochleates, but are more efficiently made, from a cost and a time perspective. The method generally includes the step of introducing a cargo moiety to a liposome in the presence of a solvent such that the cargo moiety associates with the liposome.
Without wishing to be bound to any particular theory, it is believed that the solvent facilitates association of the cargo moiety with the liposome, e.g., incorporation of a cargo moiety with the liposomal bilayer. For example, in some embodiments, a hydrophobic or amphipathic cargo moiety is dissolved in the solvent prior to addition to an aqueous liposomal suspension. When the solution is added to the liposomal suspension, the solvent is miscible with the water which changes the polarity and decreases the solubility of the cargo moiety in the solution. The cargo moiety then associates, at least in part, with the more hydrophobic environment of the lipid bilayer. For example, the hydrophobic portion of an amphipathic molecule may associate-itself with the lipid bilayer, leaving the remainder of the molecule to reside outside the liposome.
In another embodiment, the cargo moiety is hydrosoluble and/or hydrophilic, and the solvent creates an environment such that the cargo moiety associates with the lipid bilayer (e.g., by ionic attraction to the lipid and/or cation and/or total or partial migration into the bilayer). Additionally or alternatively, the solvent also may facilitate membrane permeation of the cargo moiety (e.g., an alcohol may be employed to enhance the permeability of the liposomal bilayer).
The invention also provides cochleates and cochleate compositions (e.g., pharmaceutical compositions), prepared by the methods of the invention.
The present invention also provides novel cochleates and cochleate compositions that include an aggregation inhibitor. These cochleates and cochleate compositions provide all the advantages of conventional cochleates, and additionally provide a cochleate or cochleate composition having a stable mean particle size and distribution. The cochleates and cochleate compositions can have, e.g., a small particle size, e.g. a mean particle size of less that 600 nm, and/or a narrow particle size range, e.g. less than about 700 nm. Moreover, the composition is stable and does not aggregate with the passage of time.
The invention also provides novel methods of formation of cochleates that allow the cochleates to be produced in any desired size range using a variety of methods. These methods do not require such steps as providing a two-phase system and/or particle size differentiation to obtain a cochleate composition having a mean particle size of less than a micrometer. The methods of the invention can be utilized with any known method of making cochleates.
The present invention also provides a composition for the safe and efficient delivery of cargo moieties in anhydrous cochleates. The invention is based, at least in part, on the discovery that protonized cargo moieties can be precipitated with a negatively charged lipid and a divalent metal cation to form anhydrous, stable and safe compositions for delivery of the moiety. Moreover, protonized cargo moieties can be included in the cochleates at surprisingly high concentrations, if desired.
The cochleates of the invention not only protect the cargo moiety from the host (e.g., from decomposition by proteolytic enzymes in the digestive tract), but also protect the host from the cargo moiety (e.g., preventing damage to vital organs caused by toxic levels of certain cargo moieties). In addition, the cochleates of the invention allow for efficient delivery of the cargo moiety across the digestive tract and to cells, e.g., by fusion and/or cellular uptake. Thus, a lower dosage of cargo moiety can be administered to generate the same beneficial results as compared to conventional preparations, while minimizing the incidence of toxic side effects and/or buildup of cargo moiety in the digestive tract
The methods of the invention are superior to those employing conventional liposomal preparations. By way of example, liposome-encapsulated tobramycin has resulted in a low bactericidal activity in vitro. In contrast, anhydrous tobramycin cochleate preparations of the present invention facilitate oral delivery with lower serum levels of drug, thereby lowering the toxicity. In addition, the anhydrous tobramycin cochleates of the invention may be absorbed via the gastrointestinal tract and delivered directly to the site of infection. Moreover, once anhydrous tobramycin cochleates are within the systemic circulation, they can be efficiently accumulated by phagocytes resulting in intracellular delivery of the drug to infected cells.
The invention also provides methods for forming cochleates that include contacting a protonized cargo moiety, a negatively charged lipid and a divalent metal cation.
The invention further provides methods of using the cochleates of the invention, including methods of administration. Finally, the invention provides methods of use, including therapeutic use, and kits directed to the manufacture and use of the cochleates and cochleate compositions of the invention.
In order to more clearly and concisely describe the subject matter of the claims, the following definitions are intended to provide guidance as to the meaning of specific terms used in the following written description, examples and appended claims.
The term “cargo moiety,” as used herein, refers to a moiety to be encochleated, and generally does not refer to the lipid and ion employed to precipitate the cochleate. Cargo moieties include any compounds having a property of biological interest, e.g., ones that have a role in the life processes of a living organism. A cargo moiety may be organic or inorganic, a monomer or a polymer, endogenous to a host organism or not, naturally occurring or synthesized in vitro and the like.
As used herein, the terms “cochleate,” “lipid precipitate” and “precipitate” are used interchangeably to refer to a lipid precipitate component that generally includes alternating cationic and lipid bilayer sheets with little or no internal aqueous space, typically stacked and/or rolled up, wherein the cationic sheet is comprised of one or more multivalent cations. Additionally, the term “encochleated” means associated with the cochleate structure.
The term “protonized cargo moiety” refers to a protonizable cargo moiety that has been protonized. “Protonizable” refers to the ability to gain one or more protons. The protonizable cargo moiety can be weakly basic, and can be protonized by acidification or addition of a proton. Additionally or alternatively, the protonizable cargo moiety can be neutral or weakly acidic and can be protonized in the same manner. Thus, the protonizable cargo moiety can be an anionic or a neutral cargo moiety, which is rendered cationic by protonization, or the protonizable cargo moiety can be cationic, and be rendered more cationic upon protonization. The cargo moiety can also be provided protonized. Optionally, the protonized state can be induced, e.g., by acidification or other methods, as described herein. Protonization renders the cargo moiety cationic or increases the valency of a cargo moiety that is already cationic, e.g., from monovalent to divalent or trivalent.
The term “protonization,” as used herein, refers to the process of increasing the valency of a cargo moiety. “Protonized” refers to a cargo moiety that has undergone protonization. Thus, valency can be increased, e.g. from 0 to 1, from 1 to 2, from 2 to 3, from 3 to 4, or any combination thereof, e.g., from 0 to 3. Any method to increase valency, e.g., increasing pH, can be used to protonize a cargo moiety.
The term “weakly basic cargo moiety” refers to cargo moieties that, at neutral pH, have the ability to accept protons. That is, weakly-basic cargo moieties are capable of being rendered cationic or more cationic by protonization. As such, weakly basic cargo moieties can be anionic or neutral, and be rendered cationic by protonization. Alternatively, weakly basic cargo moieties can be cationic, and can be rendered more cationic, i.e., polycationic, by protonization.
The term “weakly acidic cargo moiety” refers to cargo moieties that, at neutral pH, have the ability to give up protons. “Protonizable weakly acidic cargo moieties,” due to their weak acidity, have the ability to accept protons at decreased pH.
“Aminioglycoconjugates,” as used herein, refer to compounds that include an amino sugar or carbohydrate covalently linked with another moiety. Exemplary subgroups of aminoglycoconjugates include, but are not limited to, aminoglycoproteins, aminoglycosides, glycosaminoglycans, and aminoglycopeptides.
“Aminoglycopeptides” are compounds that include an amino sugar or carbohydrate covalently linked to one or more peptides, including synthetic or chemically modified derivatives. Aminoglycopeptides include, but are not limited to vancomycin, teicoplanin, bleomycin, peptidolglycan, ristocetin, sialoglycoproteins, orienticin, avaporcin, helevecardin, galacardin, and actinoidin. Derivatives of these compounds also are included, e.g., those provided by reductive alkylation of reactive amines. See, Sundram et al., J. Org. Chem. 60:1102-03 (1995). U.S. Pat. Nos. 4,639,433, 4,643,987, and 4,698,327, teach N-alkyl and N-acyl derivatives of vancomycin. European Patent Nos. 435 503A1 and 667 353 A1, described reductive alkylations of a variety of aminoglycopeptides including vancomycin and orienticin A.
“Aminoglycosides” are compounds that include at least two amino sugars linked by glycoside bonds to a streptidine or a 2-deoxystreptamine or their analogs. Analogs are meant to include aminoglycosides modified, e.g., to increase resistance to enzyme cleavage. Such derivatives (e.g., amikacin, a semisynthetic derivative of kanamycin), are necessary for treatment of individuals or populations that have built up resistance to other aminoglycosides, and all such derivatives developed presently or in the future are aminoglycosides that fall within the scope of the present invention. Analogs also are meant to include the structurally related aminocyclitols (e.g., spectinomycin). Aminoglycosides include, but are not limited to, gentamicin, netilmicin, tobramycin, amikacin, kanamycin A, kanamycin B, neomycin, paromomycin, neamine, streptomycin, dihydrostreptomycin, apramycin, ribostamycin, and spectinomycin. Aminoglycosides can optionally be grouped as streptomycins (e.g., streptomycin and dihydrostreptomycin), kanamycins (e.g., kanamycin, amikacin, tobramycin), gentamicins (e.g., gentamicin and netilmicin), and neomycins. Apramycin and specinomycin are aminoglycosides typically used by veterinarians to treat non-human animals.
“Echinocandins” are large lipopeptide molecules, which are active as antifungal agents. Echinocandins act by inhibiting glucan synthesis via inhibition of 1,3-beta-D-glucan synthase. This interferes with the synthesis of chitin, an important cell-wall component, and results in fungal cell lysis. These drugs have fungicidal activity against a vast species of fungi, e.g., Candida and Aspergillus. Examples of echinocandins include, but are not limited to, caspofungin, echinocandin B, aculeacin A, micafungin, anidulafungin, cilofungin, and pneumocandin. Any antifungal molecule with an echinocandin core structure is meant to be included.
As used herein, the term “peptide” refers to a compound containing two or more amino acids, such as a protein. The term “nucleotide” refers to one or more purine or pyrimidine molecules attached to a backbone. The backbone can be a sugar-phosphate backbone, or a modified backbone, e.g., a morpholino backbone. The terms “protonized peptide” and “protonized nucleotide” are meant to include any peptide or nucleotide that can be rendered divalent or polyvalent.
“Carbohydrates” include any carbohydrate including those that include one or more monosaccharides, disaccharides, oligosaccharides or polysaccharides, and their derivatives.
Cochleates
Cochleate delivery vehicles represent a unique technology platform suitable for the oral and systemic administration of a wide variety of molecules with important therapeutic biological activities, including drugs, genes, and vaccine antigens. Miller et al., J Exp Med 176:1739-1744 (1992); Gould-Fogerite and Mannino, J. Liposome Res 6(2):357-79 (1996); Mannino and Gould-Fogerite, New Generation Vaccines, ch. 18, pp 229-39 (Marcel Dekker, New York, N.Y., Myron M. Levine, Ed. 2nd ed. 1997); Gould-Fogerite et al., Advanced Drug Delivery Reviews 32(3):273-387 (1998); Gould-Fogerite and Mannino, Methods in Molecular Medicine, Vaccine Adjuvants: Preparation Methods and Research Protocols pp 179-196 (Humana Press, Totowa 1999); Gould-Fogerite et al., J Liposome Research 10(4): 339-358 (2000); U.S. Pat. No. 5,834,015; Gould-Fogerite et al., Gene 84:429-438 (1989); Zarif et al., J. Liposome Research-60(4), 523-538 (2000); Zarif et al., Antimicrobials Agents and Chemotherapy 44(6):1463-1469 (2000); Santangelo et al., Antimicrobials Agents and Chemotherapy 44(9):2356-2360 (2000); Parker et al., Methods in Enzymology: Antisense Technology, Part B, 314: 411-29 (M. Ian Phillips, Ed., 1999).
Cochleate formulation technology is particularly applicable to macromolecules as well as small molecule drugs that are hydrophobic, positively charged, negatively charged and/or possess poor oral bioavailability. Proof-of-principle studies for cochleate mediated oral delivery of macromolecules as well as small molecule drugs is being carried out in appropriate animal models with well established, clinically important drugs which currently can only be effectively delivered by injection (e.g., antifungal agents such as amphotericin B).
The cochleate structure provides protection from degradation for associated “encochleated” moieties. Divalent cation concentrations in vivo in serum and mucosal secretions are such that the cochleate structure is maintained. Hence, the majority of cochleate-associated molecules are present in the inner layers of a primarily solid, non-aqueous, stable, impermeable structure. Since the cochleate structure includes a series of solid layers, components within the interior of the cochleate structure remain substantially intact, even though the outer layers of the cochleate may be exposed to harsh environmental conditions or enzymes. In an exemplary method of cochleate formation, liposomes, which include negatively charged lipids associated with a cargo moiety, are exposed to a cation, e.g., calcium, that interacts with the liposomes to displace water and condense the lipid. The cation/lipid sheets “roll-up” and/or stack against each other to minimize contact with water, which provides an environment for the encochleated molecule that is substantially free of water. This structure provides protection to encochleated molecules from digestion in the stomach.
The cochleate interior is primarily free of water and resistant to penetration by oxygen. Oxygen and water are primarily responsible for the decomposition and degradation of cargo moieties (e.g., drugs and nutrients), which leads to reduced shelf-life. Accordingly, encochleation also imparts extensive shelf-life stability. For example, for DNA vaccine-cochleates, the encochleation efficiency, the percentage of supercoiled versus relaxed plasmid, and immunogenicity are equivalent to fresh preparations for more than one year.
With respect to storage, cochleates can be stored in cation-containing buffer, or lyophilized or otherwise converted to a powder, and stored at room temperature. If desired, the cochleates also can be reconstituted with liquid prior to administration. Cochleate preparations have been shown to be stable for more than two years at 4° C. in a cation-containing buffer, and at least one year as a lyophilized powder at room temperature.
As used herein, the term “multivalent cation” refers to a divalent cation or higher valency cation, or any compound that has at least two positive charges, including mineral cations such as calcium, barium, zinc, iron and magnesium and other elements capable of forming ions or other structures having multiple positive charges capable of chelating and bridging negatively charged lipids. Additionally or alternatively, the multivalent cation can include other multivalent cationic compounds, e.g., cationic or protonized cargo moieties. The term “divalent metal cation,” as used herein, refers to a metal having two positive charges.
The lipid employed in the present invention preferably includes one or more negatively charged lipids. As used herein, the term “negatively charged lipid” includes lipids having a head group bearing a formal negative charge in aqueous solution at an acidic, basic or physiological pH, and also includes lipids having a zwitterionic head group.
The cochleates of the invention also can include non-negatively charged lipids (e.g., positive and/or neutral lipids). Preferably, a majority of the lipid is negatively charged. In one embodiment, the lipid is a mixture of lipids, comprising at least 75% negatively charged lipid. In another embodiment, the lipid includes at least 85% negatively charged lipid. In other embodiments, the lipid includes at least 90%, 95% or even 99% negatively charged lipid. All ranges and values between 60% and 100% negatively charged lipid are meant to be encompassed herein.
The negatively charged lipid can include soy-based lipids. Preferably, the lipid includes phospholipids, such as soy-based phospholipids. The negatively charged lipid can include phosphotidyl serine (PS), dioleoylphosphatidylserine (DOPS), phosphatidic acid (PA), phosphatidylinositol (PI), and/or phosphatidyl glycerol (PG) and or a mixture of one or more of these lipids with other lipids. Additionally or alternatively, the lipid can include phosphatidylcholine (PC), phosphatidylethanolamine (PE), diphosphotidylglycerol (DPG), dioleoyl phosphatidic acid (DOPA), distearoyl phosphatidylserine (DSPS), dimyristoyl phosphatidylserine (DMPS), dipalmitoyl phosphatidylglycerol (DPPG) and the like.
The lipids can be natural or synthetic. For example, the lipid can include esterified fatty acid acyl chains, or organic chains attached by non-ester linkages such as ether linkages (as described in U.S. Pat. No. 5,956,159), disulfide linkages, and their analogs.
In one embodiment the lipid chains are from about 6 to about 26 carbon atoms, and the lipid chains can be saturated or unsaturated. Fatty acyl lipid chains useful in the present invention include, but are not limited to, n-tetradecanoic, n-hexadecanoic acid, n-octadecanoic acid, n-eicosanoic acid, n-docosanoic acid, n-tetracosanoic acid, n-hexacosanoic acid, cis-9-hexadecenoic acid, cis-9-octadecenoic acid, cis,cis-9,12-octadecedienoic acid, all-cis-9,12,15-octadecetrienoic acid, all-cis-5,8,11,14-eicosatetraenoic acid, all-cis-4,7,10,13,16,19-docosahexaenoic acid, 2,4,6,8-tetramethyl decanoic acid, and lactobacillic acid, and the like.
The cochleates of the invention can further include additional compounds known to be used in lipid preparations, e.g., cholesterol, and/or pegylated lipid. Pegylated lipid includes lipids covalently linked to polymers of polyethylene glycol (PEG). PEG's are conventionally classified by their molecular weight, thus PEG 6,000 MW, e.g., has a molecular weight of about 6000. Adding pegylated lipid generally will result in an increase of the amount of compound (e.g., peptide, nucleotide, and nutrient) that can be incorporated into the cochleate. An exemplary pegylated lipid is dipalmitoylphosphatidylehtanolamine (DPPE) bearing PEG 5,000 MW.
Methods of Forming Cochleates
In one aspect, the invention provides methods for forming cochleates. Any known method can be used to form cochleates, including but not limited to those described in U.S. Pat. Nos. 5,994,318 and 6,153,217, the entire disclosures of which are incorporated herein by this reference.
In one embodiment, the method generally includes introducing a cargo moiety to a lipid in the presence of a solvent, adding an aqueous solution to form liposomes, and precipitating to form a cochleate.
In a preferred embodiment, the method generally includes introducing a cargo moiety to a liposome in the presence of a solvent such that the cargo moiety associates with the liposome, and precipitating the liposome to form a cargo moiety-cochleate.
The step of introducing a cargo moiety to a liposome in the presence of a solvent can be achieved in a variety of ways, all of which are encompassed within the scope of the present invention. In one embodiment, the cargo moiety is introduced by introducing a solution of the solvent and the cargo moiety to the liposome. Preferably, the liposome is in a liposomal suspension, preferably, an aqueous liposomal suspension. In a preferred embodiment, the solution is introduced to the liposome by dropwise addition of the solution. In other embodiments, the solution can be added by continuous flow or as a bolus. In addition the solution may be introduced to dried lipid, with water added before, after or with the solution.
In another embodiment, the cargo moiety is introduced to the liposome prior to or after the solvent. For example, the cargo moiety may be introduced to a liposomal suspension that includes the solvent. The mixture can then be agitated, mixed, vortexed or the like to facilitate association of the cargo moiety with the liposome. The cargo moiety introduced may be in a powder or a liquid form.
An antioxidant (e.g., Vitamin E) may also be employed in the methods of the present invention. It can be introduced with the cargo moiety or with the liposome. Preferably, it is incorporated into the liposomal suspension or a solution of the cargo moiety and solvent.
The liposome may be prepared by any known method of preparing liposomes. Thus, the liposomes may be prepared for example by solvent injection, lipid hydration, reverse evaporation, freeze drying by repeated freezing and thawing. The liposomes may be multilamellar (MLV) or unilamellar (ULV), including small unilamellar vesicles (SUV). The concentration of lipid in these liposomal solutions can be from about 0.1 mg/ml to 500 mg/ml. Preferably, the concentration of lipid is from about 0.5 mg/ml to about 50 mg/ml, more preferably from about 1 mg/ml to about 25 mg/ml.
The liposomes may be large unilamellar vesicles (LUV), stable plurilamellar vesicles (SPLV) or oligolamellar vesicles (OLV) prepared, e.g., by detergent removal using dialysis, column chromatography, bio beads SM-2, by reverse phase evaporation (REV), or by formation of intermediate size unilamellar vesicles by high pressure extrusion. Methods in Biochemical Analysis, 33:337 (1988). Liposomes made by all these and other methods known in the art can be used in practicing this invention.
In a preferred embodiment at least majority of the liposomes are unilamellar. The method can further include the step of filtering a liposomal suspension and/or mechanically extruding the suspension through a small aperture that includes both MLV and ULV liposomes, such that a majority of the liposomes are ULV. In preferred embodiments, at least 70%, 80%, 90% or 95% of the liposomes are ULV.
The method is not limited by the method of forming cochleates. Any known method can be used to form cochleates from the liposomes of the invention (i.e., the liposomes associated with the cargo moiety). In a preferred embodiment, the cochleate is formed by precipitation. The liposome can be precipitated with a multivalent cation to form a cargo moiety-cochleate. The multivalent cation can consist entirely or consist essentially of a cationic metal, including, but not limited to calcium, magnesium, barium, zinc, and/or iron. Additionally or alternatively, the multivalent cation can include other multivalent cationic compounds. As used herein, the term “multivalent” refers to ions having a valency of at least 2, e.g., divalent, trivalent, etc.
Any suitable solvent can be employed in connection with the present invention. Solvents suitable for a given application can be readily identified by a person of skill in the art. Preferably, the solvent is an FDA acceptable solvent.
The solvent can be an organic solvent or an inorganic solvent. In one embodiment, the solvent is a water miscible solvent. Suitable solvents include but are not limited to dimethylsulfoxide (DMSO), a methylpyrrolidone, N-methylpyrrolidone (NMP), acetonitrile, alcohols, e.g., ethanol (EtOH), dimethylformamide (DMF), tetrahydrofuran (THF), and combinations thereof. In general, the cargo moiety concentration within the solvent is between about 0.01 mg/ml and 200 mg/ml. Preferably, the cargo moiety concentration is between about 0.05 mg/ml and about 100 mg/ml, more preferably between about 0.1 mg/ml and 20 mg/ml.
The solvent can optionally be removed, e.g., before the formation of liposomes, at the liposome stage and/or after the cochleates are formed. Any known solvent removal method can be employed. For example, solvent may be removed from the liposomal suspension by tangential flow and/or filtration and/or dialysis, or from the cochleates by washing, filtration, centrifugation, and/or dialysis. The cochleates can be washed, e.g., with buffer or water, optimally with calcium or another cation.
Utilizing the methods of the invention a wide range of lipid to cargo moiety ratios can be achieved. Different ratios can have varying biological activity. The amount of cargo moiety incorporated into the cochleates can be varied as desired. The optimal lipid:cargo moiety ratio for a desired purpose can readily be determined without undue experimentation. The cochleates can be administered to the targeted host to ascertain the nature and tenor of the biologic response to the administered cochleates. It is evident that the optimized ratio for any one use may range from a high ratio to a low ratio to obtain maximal amount of cargo moiety in the cochleates. All ratios disclosed herein are w/w, unless otherwise indicated. In one embodiment, the ratio of lipid to cargo moiety is between about 10,000:1 and 1000:1. Ratios in this range may be suitable when it is desired to administer small amounts of the moiety, (e.g., in the case of administration of radioactive agents or highly active, rare or expensive molecules). In another embodiment, the ratio is between about 8,000:1 and 4,000:1, e.g., about 6,000:1. Such a ratio may be suitable, e.g., in delivering porphyrins. In yet another embodiment, the ratio is between about 5,000:1 and 50:1. In yet another embodiment, the ratio of the lipid to the cargo moiety is between about 20:1 and about 0.5:1. In another embodiment, the ratio of the lipid to the cargo moiety is between about 1:1 and about 10:1. Such a ratio may be suitable, e.g., for delivery of an antifungal agent. In yet another embodiment, the ratio of lipid to the cargo moiety is about 2:1, about 3:1, or between about 1.5:1 and 3.5:1. All individual values and ranges between about 0.25:1 and about 40,000:1 are within the scope of the invention. Further values also are within the scope of the invention. The cochleate formulations also can be prepared both with and without targeting molecules (e.g., fusogenic molecules, such as Sendai virus envelope polypeptides), to target specific cells and/or tissues.
In some embodiments, the cargo moiety is hydrophobic. In others, it is amphipathic. In still others, it is hydrophilic and/or hydrosoluble. Exemplary cargo moieties are disclosed below.
In preferred embodiments, hydrophobic cargo moiety cochleates (e.g., beta-carotene cochleates) are formed by introducing a hydrophobic cargo moiety to a liposome in the presence of a solvent such that the hydrophobic cargo moiety associates with the liposome, and precipitating the liposome to form a hydrophobic cargo moiety-cochleate. In particularly preferred embodiments, the loading of hydrophobic cargo moiety in the cochleate is considerably higher than the loading observed when cochleates are formed using conventional methods, i.e., those described in U.S. Pat. No. 5,994,318.
Formation of the cochleates of the invention in the above methods involves crystallization of multivalent cation with negatively charged lipids. It is evident, therefore, that all of the parameters that govern crystallization, e.g., temperature, lipid concentration, multivalent cation concentrations, rate of cation addition, pH and rate of mixing, can be utilized to regulate cochleate formation. In certain embodiments, ionic conditions can be created or adjusted to affect the efficiency of the association and/or the encochleation of the cargo moiety. For example, increasing the salt concentration in a liposomal suspension can render the environment less hospitable to a hydrophobic or amphipathic cargo moiety, thereby increasing liposome and cochleate loading efficiency. Ionic conditions can also affect the ultimate structure of the cochleate generated. High loads of a cargo moiety can also affect the highly ordered structure observed in cochleates formed, e.g., exclusively from calcium and PS. Additionally or alternatively, pH conditions can be created or adjusted to affect the loading and structure of the resulting cochleates. Such variations can readily be manipulated by the skilled practitioner using no more than the instant specification and routine experimentation. In addition, because a cochleate is highly thermodynamically stable, once a cochleate formulation method is developed for a given product, the end product can be made predictably and reliably.
Accordingly, in another aspect, the present invention provides methods of making anhydrous cochleates with protonized cargo moieties. The method generally includes the step of contacting a negatively charged lipid, a protonized cargo moiety and a divalent metal cation. Without wishing to be bound by any particular theory, it is believed that the negatively charged lipid forms an ionic interaction with the cationic protonized-cargo moiety. The divalent metal cation then precipitates the lipid and protonized cargo moiety to form an anhydrous cochleate.
In a preferred embodiment, the protonized cargo moiety is introduced to the negatively charged lipid. A divalent metal cation is then added to the lipid-protonized cargo moiety mixture in order to form anhydrous cochleates. The divalent metal cation can be, e.g., calcium, barium, etc. In particularly preferred embodiments, the divalent metal cation is capable of inducing the formation of an anhydrous cochleate. In other particularly preferred embodiments, the divalent metal cation is calcium.
In one embodiment, liposomes are formed that include negatively charged lipid using known methods, and the protonized cargo moiety is added prior to, during or after formation of the liposomal suspension. Alternatively, the protonized cargo moiety is introduced to a preformed liposomal suspension, e.g., as a solid or in an aqueous or organic solution.
The method can further include the step of protonizing the cargo moiety prior to or during the formation of the cochleate, e.g., by acidification. Any known method of acidification can be employed. For example, a weakly basic cargo moiety can be protonized with acidic aqueous buffer. A buffer is chosen based upon the pKa of the cargo moiety. A cargo moiety with a lower pKa would necessitate a buffer with a lower pH range than that of a cargo moiety with a higher pKa. Thus, for caspofungin, with pKa, values of 5.1, 8.7, 9.7 and 10.7, a buffer with a pH range of between 4.5 and 5.5 would be sufficient to maintain its multivalency. Buffers with a pH range suitable for acidification can readily be identified by the skilled practitioner based upon the cargo moiety being protonized. Suitable buffers include low molecular weight buffers having an acidic pKa, e.g., amino acids and TES. Acidic buffers are known in the art, and identification of a variety of acidic buffers would require no more than routine experimentation by one of ordinary skill in the art. Alternatively, the weakly basic cargo moiety can be protonized by slow addition of an acid, e.g., hydrochloric acid, to an aqueous solution of lipid and weakly basic cargo moiety.
In still other embodiments, the protonizable cargo moiety has more than one pKa value. In preferred embodiments, the pH is lowered to below the highest pKa value. In other preferred embodiments, pH is lowered to below the second highest pKa value. In other preferred embodiments, the pH is lowered to below the third, fourth, fifth or even sixth highest pKa value. In yet other preferred embodiments, the pH is lowered to below the lowest pKa value.
Optionally, the cargo moiety can be protonized in the lipid-cargo moiety mixture, e.g., by lowering the pH or introducing the cargo moiety to a suspension of lipids at a low pH. Because of its cationic nature, the protonized cargo moiety tends to associate with the negatively charged surface of the liposome bilayers.
In yet other embodiments, the cargo moieties can be protonized prior to incorporation into the cochleates. For example, they can be obtained or purchased protonized from the manufacturer. Additionally or alternatively, they can be protonized, isolated as a protonized cargo moiety, and subsequently incorporated into a cochleate at a suitable pH. A suitable pH is a pH that allows the cargo moiety to remain protonized, and can be readily determined by the skilled artisan.
In other embodiments, the pH of the resultant anhydrous cochleates in solution can be adjusted using, e.g., acid. Without wishing to be bound by any particular theory, it is believed that this would help to maintain the protonized cargo moiety within the cochleate structure.
In another aspect, the present invention generally is directed to methods of making cochleates that include an aggregation inhibitor. The aggregation inhibitor can be introduced prior to, during or after formation of cochleates. That is, the aggregation inhibitor can be added to the lipid-cargo moiety solution, to the liposomal solution or to the precipitated cochleate. For example, in one embodiment, the aggregation inhibitor is introduced to a liposomal suspension from which cochleates will subsequently be formed (e.g., by addition of cation or dialysis). That is, the aggregation inhibitor may be introduced prior to formation of liposomes, e.g., it may be added to dried lipid prior to suspension or added directly to a liposomal suspension, before of after addition of a cargo moiety. In such embodiments, the cochleates may be initially formed in the desired size range and aggregation thereafter prevented by the presence of the aggregation inhibitor.
In other embodiments, the methods of the invention can include the step of introducing an aggregation inhibitor to a cochleate composition. For example, the method can further include forming cochleates (prior to introducing the aggregation inhibitor). The method can include providing cochleates already formed, e.g., cochleates obtained from a supplier. The method can further include the step of disaggregating cochleates by adding an aggregation inhibitor to aggregated cochleates.
In still other embodiments, aggregated cochleates may be disaggregated using alternative disaggregation methods, e.g., homogenization, and an aggregation inhibitor can be introduced in order to prevent reaggregation.
In yet another embodiment, the aggregation inhibitor can be introduced during the formation of the cochleate, e.g., it can be added with the cation or during dialysis.
In a preferred embodiment, the aggregation inhibitor is added in an amount suitable for modulating the resulting cochleate to the desired size.
The method can include forming cochleates with any or all of the optional ingredients disclosed herein. For example, the cochleates can include additional cationic compounds, protonized cargo moieties, non-negative lipids, and/or aggregation inhibitors.
Any of the methods described herein can be utilized to produce anywhere from about 1 mg to about 500 g of cochleates in one batch. A smaller batch may be preferred in a laboratory setting where characterization of cochleates is desired. On the other hand, larger batches may be preferred in a manufacturing setting where mass production is desired. Preferably, larger batches are at least 50 g, and more preferably at least 75 g.
FIG. 2 illustrates an exemplary method of the present invention, wherein drug-liposomes are obtained by addition of a hydrophobic drug in solvent (e.g., DMSO, DMF, THF, EtOH), optionally with an antioxidant (e.g., Vitamin E), to a liposomal suspension. A liposomal suspension is prepared by vortexing lipid (e.g., soyPS) and water and filtered, however, other methods of obtaining liposomal suspensions can be employed in the methods of the present invention. Cochleates are precipitated out by the addition of calcium (e.g., calcium chloride), and subsequently can be washed (e.g., with calcium containing buffers) to remove any residual solvent, if desired. Alternatively, residual solvent can be removed by other methods, e.g., dialysis.
FIG. 3 illustrates another aspect of the invention, wherein hydrosoluble drugs are encochleated. In this method, a hydrosoluble drug is added directly to liposomes and subsequently precipitated. The liposomes are prepared by adding lipid (e.g., dry Soy PS powder) to water, but could be prepared or provided by any other known means.
Aggregation Inhibitors
In some preferred embodiments, the cochleates of the present invention can optionally include one or more aggregation inhibitors. The term “aggregation inhibitor,” as used herein, refers to an agent that inhibits aggregation of cochleates. The aggregation inhibitor typically is present at least on the surface of the cochleate, and may only be present on the surface of the cochleate (e.g., when the aggregation inhibitor is introduced after cochleate formation). Aggregation inhibitors can be added before, after, or during cochleate formation. The type and/or amount of aggregation inhibitor can be adjusted to obtain a desired cochleate size and/or distribution. Additionally or alternatively, aggregation inhibitor(s) can be used to stabilize cochleate size and/or size distribution such that aggregation of cochleates is minimized or eliminated.
Such compositions are advantageous for several reasons including that smaller cochleates can allow for greater uptake by cells and rapid efficacy. Such a composition is suitable, e.g., when it is desired to rapidly and effectively deliver a cargo moiety (e.g., an antifungal or antibacterial agent against a fungal or bacterial infection). Moreover, particle size can have a targeting affect in that some cells may take up particles of a certain size more or less effectively. Size may also affect the manner in which cochleates interact with a cell (e.g., fusion events or uptake).
Aggregation inhibitors work in part by modifying the surface characteristics of the cochleates such that aggregation is inhibited. Aggregation can be inhibited, for example, by steric bulk around the cochleate, which inhibits aggregation and/or changes the nature of the cochleate structure, e.g., a change in the surface hydrophobicity and/or surface charge.
The terms “coat,” “coated,” “coating,” and the like, unless otherwise indicated, refer to an agent (e.g. an aggregation inhibitor) present at least on the outer surfaces of a cochleate. Such agents may be associated with the bilayer by incorporation of at least part of the agent into the bilayer, and/or may be otherwise associated, e.g., by ionic attraction to the cation or hydrophobic or ionic attraction to the lipid.
As discussed herein, cochleates can be formed by the calcium induced restructuring and fusion of lipid, e.g., phospholipid such as phosphatidylserine (PS). Due to the hydrophobic nature of the surfaces of cochleates in aqueous, calcium containing solutions, cochleates formed without the aggregation inhibitors of the invention can aggregate and form larger masses, e.g., needle-like structures in aspirin cochleates (FIG. 37A, right panel). It has been discovered that restricting and/or inhibiting the interaction of liposomes that can coalesce into cochleates at the time of cation addition limits the size of the resultant cochleate crystal, and prevents aggregation into larger particles. The addition of an aggregation inhibitor (e.g., casein) to liposomes prior to the addition of calcium results in stable non-aggregated nanocochleate structures (FIG. 37A, left panel).
The type and/or amount of aggregation inhibitor used can also determine the size of resulting cochleate. The presence of an aggregation inhibitor in differing concentrations also allows regulation of cochleate size distribution.
It also has been discovered that addition of one or more aggregation inhibitors after formation of cochleates also inhibits and even reverses aggregation. For example, it is shown in FIG. 35 that the addition of half and half, whole milk, and fat free milk to Rhodamine-PE cochleates inhibits aggregation. It can also be noted that the milk products with more fat content (milk and half and half) inhibited aggregation more than the fat free milk, which has less fat content. Additionally, the addition of an aggregation inhibitor (milk) to aggregated cochleates has been demonstrated to disaggregate the cochleates as depicted in FIG. 36.
Suitable aggregation inhibitors that can be employed in accordance with the present invention, include but are not limited to at least one of the following: casein, κ-casein, milk, albumin, serum albumin, bovine serum albumin, rabbit serum albumin, methylcellulose, ethylcellulose, propylcellulose, hydroxycellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, polyvinyl pyrrolidone, carboxymethyl cellulose, carboxyethyl cellulose, pullulan, polyvinyl alcohol, sodium alginate, polyethylene glycol, polyethylene oxide, xanthan gum, tragacanth gum, guar gum, acacia gum, arabic gum, polyacrylic acid, methylmethacrylate copolymer, carboxyvinyl polymer, amylose, high amylose starch, hydroxypropylated high amylose starch, dextrin, pectin, chitin, chitosan, levan, elsinan, collagen, gelatin, zein, gluten, carrageenan, carnauba wax, shellac, latex polymers, milk protein isolate, soy protein isolate, whey protein isolate and mixtures thereof.
A preferred aggregation inhibitor is casein. Casein is a highly phosphorylated, calcium binding protein. Without wishing to be bound to any particular theory, it is believed that calcium mediates an interaction between negatively charged lipid (e.g., PS) and casein, thereby changing the surface properties of cochleates such that aggregation is inhibited. Another preferred aggregation inhibitor is milk and other milk products such as Half and Half, cream etc. Preferred milk products also contain casein. Another preferred aggregation inhibitor is an excipient, e.g., methylcellulose. Other preferred aggregation inhibitors include albumin, serum albumin, bovine serum albumin and rabbit serum albumin.
More than one aggregation inhibitor may be employed in the compositions of the invention. For example, both milk and methylcellulose may be used as an aggregation inhibitor.
In one embodiment, the cochleate compositions of the invention include between about 10% and about 0.1% aggregation inhibitor. Preferably, the aggregation inhibitor comprises about 1% of the cochleate composition.
In another embodiment, the cochleate compositions of the invention include an aggregation inhibitor to lipid ratio of between about 0.1:1 to about 4:1 by weight.
Preferably, the aggregation inhibitor to lipid ratio is about 1:1. A person of ordinary skill in the art will readily be able to determine the amount of aggregation inhibitor needed to form cochleates of the desired size with no more than routine experimentation.
Cochleate Size and Distribution
The formation of cochleates can be envisioned as a crystallization event that spontaneously occurs upon the interaction of charged lipids and oppositely charged multivalent cations. Modulating of the size of cochleate crystals formed, however, has prior to the present invention proved difficult.
In aqueous suspension, plain cochleates generally aggregate and upon long term storage form larger masses which can be several microns in size. Because of the association of the calcium with the lipid head group, the surfaces of cochleates have a hydrophobic character. When suspended in aqueous buffer, cochleate aggregation is a consequence of hydrophobic interactions, minimizing the amount of surface area exposed to water. FIG. 30 is a schematic model of cochleate aggregation in aqueous solution.
It has been discovered that aggregation can be inhibited and even reversed, and individual cochleate particles can be stabilized by changing the surface properties of the cochleates and thereby inhibiting cochleate-cochleate interaction. Aggregation can be inhibited by including in the liposome suspension a material that prevents liposome-liposome interaction at the time of calcium addition and thereafter. Alternatively, the aggregation inhibitor can be added after formation of cochleates. Additionally, the amount of aggregation inhibitor can be varied, thus allowing modulation of the size of the cochleates.
FIG. 31 is a schematic model of cochleates coated in proteins to reduce the amount of cochleate aggregation to near zero. As demonstrated in greater detail below, the resulting cochleates are surprisingly small. Particle size analysis demonstrates that these formulations are stable nanocochleates. Additional experiments, presented below in the Examples, have extended these observations providing the conceptual basis for the development of protocols for the preparation of stabilized nanocochleate formulations of defined size.
FIG. 32 is a schematic diagram of an exemplary method of making cochleates of the invention by adding an aggregation inhibitor subsequent to cochleate formation. Accordingly, in one aspect, the invention provides a cochleate composition comprising a plurality of cochleates and an aggregation inhibitor. In a preferred embodiment, the aggregation inhibitor comprises a coating on the cochleates. Such a “coating” can be formed by addition of the aggregation inhibitor after formation of cochleates. The amount of aggregation inhibitor employed and the point at which the aggregation inhibitor is added can be used to control the particle sizes of the cochleates.
Accordingly, the present invention provides a cochleate composition comprising a plurality of cochleates and an aggregation inhibitor having a desired particle size distribution, and methods of making the same. As demonstrated herein, the amount of aggregation inhibitor and/or time of addition can be varied to modulate and/or stabilize the size and/or size distribution of a cochleate composition.
In one embodiment, the aggregation inhibitor can be employed to achieve cochleates that are significantly smaller and have narrower particle size distributions than compositions without aggregation inhibitors as demonstrated, e.g., in FIG. 34. Such compositions are advantageous for several reasons including that they can allow for greater uptake by cells (see e.g., FIG. 33), and rapid efficacy (see e.g., FIGS. 46, 47, 49 and 50). Such a composition is suitable, e.g., when it is desired to rapidly and effectively deliver a cargo moiety (e.g., an antifungal or antibacterial agent against a fungal or bacterial infection). Moreover, cochleate size can have a targeting affect in that some cells may take up particles of a certain size more or less effectively. Size may also affect the manner in which cochleates interact with a cell (e.g., fusion events or uptake).
In another embodiment, the aggregation inhibitor can be employed in an amount to achieve cochleate-compositions having a particle size relatively larger than that which can be achieved without or with other aggregation inhibitors (e.g., if more and/or a different aggregation inhibitor used). Such a composition can be useful, e.g., when delayed uptake and/or release of the cargo molecule is desired, or when targeted cells or organs more effectively take up cochleates in the relatively larger size range. Such compositions also may have sustained activity (relative to smaller cochleate compositions) because it can take longer for the cargo moiety to be released from a larger cochleate, e.g., if multiple fusion events are required.
In yet another embodiment, the amount and/or types of aggregation inhibitor can be chosen to manufacture a cochleate composition that has a wide particle size distribution such that the cargo moiety is released over a period of time because smaller cochleates are rapidly taken up initially followed by take up or fusion events with increasingly larger cochleates. In addition, size may not only affect what type of cells take up the cochleate, but also how the cochleates interact with certain cells, e.g., size may effect whether a cochleate is taken up by a cell or undergoes one or more fusion events with a cell.
Moreover, in yet further embodiments, several compositions can be combined for desired release profiles, e.g., a pulsed released, or combined release. For example, a rapid release nanocochleate composition can be mixed with a delayed-release larger size or even standard cochleate composition, such that an immediate and a delayed release are both realized. In an exemplary case, both small and large antibiotic cochleates are administered in order to treat a subject with a high initial dose (small cochleates) and to maintain enough antibiotic in the serum to be effective against remaining bacteria (large cochleates). In addition, the cochleate compositions may have different cargo moieties, e.g., a stomach protecting medication can be formulated with nanocochleates for initial release (or a large distribution for long term release), and one or more non-steroidal anti-inflammatory drugs can be formulated with larger cochleates (NSAID) for release after the stomach protecting medication is released.
An aggregation inhibitor also can be employed to stabilize particle size and particle size distribution. For example, it can be used to “lock-in” the cochleate size and distribution of standard cochleates and/or cochleates having an aggregation inhibitor. While the cochleates of the invention typically are stable over long periods of time, standard cochleates (cochleates formed without aggregation inhibitors) can tend to aggregate over time. Thus, standard cochleates can be reduced in size and/or stabilized by addition to such aggregation inhibitors, e.g., addition of methylcellulose after cochleate formation. FIG. 54 shows the decrease in size of caspofungin cochleates which have been homogenized and treated with bovine serum albumin.
Cochleates formed in the presence of aggregation inhibitors do not aggregate. Accordingly, such compositions are advantageous for several reasons including, e.g., greater uptake by cells, and increased efficacy. Cochleate compositions of the invention preferably have a mean diameter less than about 5, 4, 3, 2, or 1 micrometer. Preferably, the cochleate compositions have a mean diameter less than about 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm. All individual values between these values (880, 435, 350), are meant to be included and are within the scope of this invention. In another embodiment, cochleate compositions of the invention include cochleate populations having a mean diameter about equal to or greater than about 1 micrometer, e.g., 2, 3, 4, 5, 10, 50, or 100 micrometers. All individual values and ranges within these ranges are meant to be included and are within the scope of this invention.
Preferably, the size distribution is narrow relative to that observed in standard cochleates (cochleates formed without aggregation inhibitors). As demonstrated, e.g. in FIG. 34, the size distribution of cochleate compositions with aggregation inhibitors is significantly improved relative to that observed in standard cochleate compositions. Preferably, the cochleates have a size distribution of less than about 30, 20, 10, 5, 3 or 1 μm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm. All individual values between these values (550 nm, 420 nm, 475 nm, etc.), are meant to be included and are within the scope of this invention. Such compositions are particularly desirable where uptake by macrophages is desired. It can readily be appreciated that particle size can be adjusted to a size suitable for uptake by desired organs or cells and/or unsuitable for uptake by organs or cells. In another embodiment, a wider size distribution of cochleates is employed, e.g., about 10, 20, 50, 100, 200 . . . 500 micrometers. All individual values within these ranges are meant to be included and are within the scope of this invention. Such compositions can be useful for long term release of cargo moieties.
Additionally, as discussed above, the invention contemplates combination of cochleate populations with one or more cargo moieties, one or more size distributions, and one or more mean diameter, to achieve a desired release pattern, e.g., pulsed release, delayed release and/or timed release of different cargo-moieties.
Cargo Moieties
The cochleates of the present invention are preferably associated or “loaded” with a cargo moiety. A “cargo moiety” is a moiety to be encochleated, and generally does not refer to the lipid and ion employed to precipitate the cochleate. Cargo moieties include any compounds having a property of biological interest, e.g., ones that have a role in the life processes of a living organism. A cargo moiety may be organic or inorganic, a monomer or a polymer, endogenous to a host organism or not, naturally occurring or synthesized in vitro and the like.
Thus, examples include vitamins, minerals, nutrients, micronutrients, amino acids, toxins, microbicides, microbistats, co-factors, enzymes, polypeptides, polypeptide aggregates, polynucleotides, lipids, carbohydrates, nucleotides, starches, pigments, fatty acids, saturated fatty acids, monounsaturated fatty acids, polyunsaturated fatty acids, flavorings, essential oils, extracts, hormones, cytokines, viruses, organelles, steroids and other multi-ring structures, saccharides, metals, metabolic poisons, antigens, imaging agents, porphyrins, tetrapyrrolic pigments, drugs and the like.
The cargo moiety can be a diagnostic agent, such as an imaging agent. Imaging agents include nuclear agents and fluorescent probes, e.g., porphyrins. Porphyrins include tetrapyrrolic agents or pigments. One such tetrapyrrolic agent is Zinc Tetra-Phenyl Porphyrin (ZnTPP), which is a hydrophobic, fluorescent molecule that has high absorption in the visible spectrum (dark purple).
The polynucleotide can be one that is expressed to yield a biologically active polypeptide or polynucleotide. Thus, the polypeptide may serve as an immunogen or, for example, have enzymatic activity. The polynucleotide may have catalytic activity, for example, be a ribosome, or may serve as an inhibitor of transcription or translation, e.g., a small interfering RNA (siRNA) or an antisense molecule. The polynucleotide can be an antisense molecule including modified antisense molecule, such as a morpholino antisense molecule. The polynucleotide can be modified, e.g., it can be synthesized to have a morpholino backbone. If expressed, the polynucleotide preferably includes the necessary regulatory elements, such as a promoter, as known in the art. A specific example of a polypeptide is insulin.
The cargo moiety can be an organic molecule that is hydrophobic in aqueous media. The cargo moiety can also be a water-soluble monovalent or polyvalent cationic molecule, anionic, or net neutral at physiological pH.
The drug can be, but is not limited to, a protein, a small peptide, a bioactive polynucleotide, an antibiotic, an antiviral, an anesthetic, antipsychotic, an anti-infectious, an antifungal, an anticancer, an immunosuppressant, an immunostimulant, a steroidal anti-inflammatory, a non-steroidal anti-inflammatory, an antioxidant, an antidepressant which can be synthetically or naturally derived, a substance which supports or enhances mental function or inhibits mental deterioration, an anticonvulsant, an HIV protease inhibitor, a non-nucleophilic reverse transcriptase inhibitor, a cytokine, a tranquilizer, a mucolytic agent, a dilator, a vasoconstrictor, a decongestant, a leukotriene inhibitor, an anti-cholinergic, an anti-histamine, a cholesterol lipid metabolism modulating agent or a vasodilatory agent. The drug can also be any over the counter (non-prescription) medication.
An antifungal drug can be a polyene macrolide, tetraene macrolide, pentaenic macrolide, fluorinated pyrimidine, imidazole, azole, triazole, halogenated phenolic ether, thiocarbamate, allylamine, sterol inhibitor, and an agent that interpolates fungal cell wall components.
Nonsteroidal anti-inflammatory drugs (NSAIDS) are typically used to treat inflammation, muscle strains, and high fever. NSAIDS function by inhibiting. cyclooxygenase-1 (COX1) and cyclooxygenase-2 (COX2). COX1 enzymes are responsible for protecting the lining of the stomach and COX2 enzymes are responsible for the production of prostaglandins, which are important in the inflammatory process. Unfortunately, commercially available preparations of NSAIDS are active against both COX1 and COX2, and therefore have unwanted side effects such as ulcers, upset stomach or nausea.
Examples of suitable drugs include Amphotericin B, acyclovir, adriamycin, carbamazepine, ivermectin, melphalen, nifedipine, indomethacin, curcumin, aspirin, ibuprofen, naproxen, acetaminophen, rofecoxib, diclofenac, ketoprofen, meloxicam, nabumetone, estrogens, testosterones, steroids, phenyloin, ergotamines, cannabinoids, rapamycin, propanadid, propofol, alphadione, echinomycin, miconazole, miconazole nitrate, ketoconazole, itraconazole, fluconazole, griseofulvin, clotrimazole, econazole, terconazole, butoconazole, oxiconazole, sulconazole, saperconazole, voriconazole, ciclopirox olamine, haloprogin, tolnaftate, naftifine, terbinafine hydrochloride, morpholines, flucytosine, natamycin, butenafine, undecylenic acid, Whitefield's ointment, propionic acid, and caprylic acid, clioquinol, selenium sulfide, teniposide, hexamethylmelamine, taxol, taxotere, 18-hydroxydeoxycorticosterone, prednisolone, dexamethasone, cortisone, hydrocortisone, piroxicam, diazepam, verapamil, vancomycin, tobramycin, teicoplanin, bleomycin, peptidolglycan, ristocetin, sialoglycoproteins, orienticin, avaporcin, helevecardin, galacardin, actinoidin, gentamycin, netilmicin, amikacin, kanamycin A, kanamycin B, neomycin, paromomycin, neamine, streptomycin, dihydrostreptomycin, apramycin, ribostamycin, spectinomycin, caspofungin, echinocandin B, aculeacin A, micafungin, anidulafungin, cilofungin, pneumocandin, geldanamycin, nystatin, rifampin, tyrphostin, a glucan synthesis inhibitor, vitamin A acid, mesalamine, risedronate, nitrofurantoin, dantrolene, etidronate, nicotine, amitriptyline, clomipramine, citalopram, dothiepin, doxepin, fluoxetine, imipramine, lofepramine, mirtazapine, nortriptyline, paroxetine, reboxetine, sertraline, trazodone, venlafaxine, dopamine, St. John's wort, phosphatidylserine, phosphatidic acid, amastatin, antipain, bestatin, benzamidine, chymostatin, 3,4-dichloroisocoumarin, elastatinal, leupeptin, pepstatin, 1,10-phenanthroline, phosphoramidon, ethosuximide, ethotoin, felbamate, fosphenytoin, lamotrigine, levitiracetam, mephenyloin, methsuximide, oxcatbazepine, phenobarbital, phensuximide, primidone, topirimate, trimethadione, zonisamide, saquinavir, ritonavir, indinavir, nelfinavir, and amprenavir.
Tyrphostin and geldanamycin (GA) target the oncoprotein/oncogene erb B2, which is overexpressed on a variety of tumor cells, and this high level of expression is functionally related to transformation.
GA is a hydrophobic small molecule drug that has been shown to have activity in vitro against cancer cell lines. It inhibits ErbB2 expression by destabilizing chaperone proteins. GA has been traditionally dissolved in DMSO for in vitro and in vivo testing. In vivo, it has anti-tumor activity, but has significant hepatotoxicity. Tyrphostin AG-825 is a tyrosine kinase inhibitor that has activity against cancer cell lines over-expressing erb B2. It inhibits its activity, and therefore cellular proliferation, but not erb B2 expression.
The drug can be a polypeptide such as cyclosporin, Angiotensin I, II and III, enkephalins and their analogs, ACTH, anti-inflammatory peptides I, II, III, bradykinin, calcitonin, b-endorphin, dinorphin, leucokinin, leutinizing hormone releasing hormone (LHRH), insulin, neurokinins, somatostatin, substance P, thyroid releasing hormone (TRH) and vasopressin.
The drug can be an antigen, but is not limited to a protein antigen. The antigen can also be a carbohydrate or DNA. Examples of antigenic proteins include membrane proteins, carbohydrates, envelope glycoproteins from viruses, animal cell proteins, plant cell proteins, bacterial proteins, and parasitic proteins.
The antigen can be extracted from the source particle, cell, tissue, or organism by known methods. Biological activity of the antigen need not be maintained. However, in some instances (e.g., where a protein has membrane fusion or ligand binding activity or a complex conformation which is recognized by the immune system), it is desirable to maintain the biological activity. In these instances, an extraction buffer containing a detergent which does not destroy the biological activity of the membrane protein is employed. Suitable detergents include ionic detergents such as cholate salts, deoxycholate salts and the like or heterogeneous polyoxyethylene detergents such as Tween, BRIG or Triton.
Utilization of this method allows reconstitution of antigens into the liposomes with retention of biological activities, and efficient association with the cochleates. The method may also be employed without sonication, extreme pH, temperature, or pressure all of which may have an adverse effect upon efficient reconstitution of the antigen in a biologically active form.
Suitable nutrients include, but are not limited to lycopene, micronutrients such as phytochemicals or zoochemicals, vitamins, minerals, fatty acids, amino acids, fish oils, fish oil extracts, saccharides, herbal products and essential oils and flavor agents. Specific examples include Vitamins A, B, B1, B2, B3, B12, B6, B-complex, C, D, E, and K, vitamin precursors, caroteniods, and beta-carotene, resveratrol, biotin, choline, inositol, gingko, lutein, zeaxanthine, quercetin, silibinin, perillyl alcohol, genistein, sulfurophane, and essential fatty acids, including eicosapentaenoic acid (EPA), gamma-3, omega-3, gamma-6 and omega-6 fatty acids, herbs, spices, and iron. Minerals include, but are not limited to boron, chromium, colloidal minerals, colloidal silver, copper, manganese, potassium, selenium, vanadium, vanadyl sulfate, calcium, magnesium, barium, iron and zinc.
As used herein, “micronutrient” is a nutrient that the body must obtain from outside sources. Generally micronutrients are essential to the body in small amounts.
The cargo moiety can be a saccharide or sweetener, e.g., saccharine, isomalt, maltodextrin, aspartame, glucose, maltose, dextrose, fructose and sucrose. Flavor agents include oils, essential oils, or extracts, including but not limited to oils and extracts of cinnamon, vanilla, almond, peppermint, spearmint, chamomile, geranium, ginger, grapefruit, hyssop, jasmine, lavender, lemon, lemongrass, marjoram, lime, nutmeg, orange, rosemary, sage, rose, thyme, anise, basil, black pepper, tea or tea extracts, an herb, a citrus, a spice or a seed.
In some preferred embodiments, the cargo moiety can be a protonized cargo moiety. In one embodiment, the cargo moiety is a protonized weakly basic cargo moiety. The pharmacokinetics of weakly basic cargo moieties (e.g., vancomycin and tobramycin), conventionally has been dominated by their poor solubility in lipids such as milk. Because of this poor solubility and the lack of water in the cochleates, it was surprising that weakly basic cargo moieties could be incorporated into cochleates at the concentrations achieved in the present invention. It has been discovered, however, that protonized weakly basic cargo moieties can be incorporated into anhydrous cochleates. Protonized neutral cargo moieties can similarly be precipitated with negatively charged lipid, provided that acidification renders them cationic. Additionally, cargo moieties suitable for use in accordance with the present invention can include protonized weakly acidic cargo moieties or protonized amphoteric cargo moieties. Weakly acidic cargo moieties or amphoteric cargo moieties may or may not include an initial positive charge. Such cargo moieties would also be rendered cationic by protonization. Protonizable cargo moieties can be negatively charged, positively charged, uncharged or zwitterionic. The invention is particularly advantageous in the preparation of protonized water-soluble cargo moieties.
In one embodiment, the protonized cargo moiety is monovalent. In other embodiments, the protonized cargo moiety is multivalent, e.g., divalent, trivalent, etc. In certain embodiments, a higher valency may be preferable due to the size and/or conformation of the cargo moiety.
Moreover, because the protonized cargo moieties are cationic, hydrous cochleates can be a made without additional cation (e.g., a metal cation, such as calcium). For example, vancomycin-cochleates have been made without cation, as described below. Anhydrous cochleates made with divalent metal cation, e.g., Ca2+, are preferred and are active against Staph. A. infection in vitro.
In one embodiment, the protonized cargo moiety is a multivalent cation (i.e., polycationic). The protonization or acidification can render a non-cationic moiety cationic or increase the valency of a cationic moiety. The protonized cargo moiety can optionally be isolated and characterized prior to formulation into a cochleate. Alternatively, the cargo moiety can be obtained or purchased protonized (e.g., vancomycin hydrochloride or caspofungin acetate).
In one embodiment, the protonized cargo moiety is a protonized peptide, such as a protonized protein.
In another embodiment, the protonized cargo moiety is a protonized nucleotide. The protonized nucleotide can be, but is not limited to a protonized DNA, a protonized RNA, a protonized morpholino, a protonized siRNA molecule, a protonized ribozyme, a protonized antisense molecule, or a protonized plasmid.
In a preferred embodiment, the cargo moiety is a drug, including, but not limited to, an aminoglyconjugate, e.g., an aminoglycoside or an aminoglycopeptide. Preferably the aminoglycoconjugate is weakly basic.
In a particularly preferred embodiment, the aminoglycoconjugate is one or more of the following: vancomycin, teicoplanin, bleomycin, peptidolglycan, ristocetin, sialoglycoproteins, orienticin, avaporcin, helevecardin, galacardin, actinoidin, gentamycin, netilmicin tobramycin, amikacin, kanamycin A, kanamycin B, neomycin, paromomycin, neamine, streptomycin, dihydrostreptomycin, apramycin, ribostamycin, and spectinomycin.
In another preferred embodiment, the cargo moiety is an echinocandin. In a particularly preferred embodiment, the echinocandin is one or more of the following: caspofungin, echinocandin B, aculeacin A, micafungin, anidulafungin, cilofungin, and pneumocandin.
The cochleates of the invention can be prepared with a wide range of cargo moiety to lipid ratios. By way of example, the ratio of cargo moiety to lipid can be between about 20,000:1 and about 0.5:1 by weight. In one embodiment the ratio is about 1:1 by weight. In others the ratio is about 2:1, 3:1, 4:1, 5:1, 10:1, 20:1, 50:1, 100:1, 200:1, or 400:1 by weight. All individual ranges and values between 20,000:1 and 0.5:1 are encompassed by the invention.
The cochleates of the present invention can optionally include one or more additional cargo moieties. The additional cargo moiety can be a second protonized cargo moiety or any other cargo moiety.
Additional pharmacologically active agents may be delivered in combination with the primary active agents, e.g., the cochleates of this invention. In one embodiment, such agents include, but are not limited to agents that reduce the risk of atherosclerotic events and/or complications thereof. Such agents include, but are not limited to beta-blockers, beta blockers and thiazide diuretic combinations, HMG CoA reductase inhibitors, statins, aspirin, ace inhibitors, ace receptor inhibitors (ARBs), and the like.
Suitable beta blockers include, but are not limited to cardioselective (selective beta 1 blockers), e.g., acebutolol (e.g., Sectral™), atenolol (e.g., Tenormin™), betaxolol (e.g., Kerlone™), bisoprolol (e.g., Zebeta™), metoprolol (e.g., Lopressor™), and the like. Suitable non-selective blockers (block beta 1 and beta 2 equally) include, but are not limited to carteolol (e.g., Cartrol™), nadolol (e.g., Corgard™), penbutolol (e.g., Levatol™), pindolol (e.g., Visken™), propranolol (e.g., Inderal™), timolol (e.g., Blockadren™), labetalol (e.g., Normodyne™, Trandate™), and the like.
Suitable beta blocker thiazide diuretic combinations include, but are not limited to Lopressor HCT, ZIAC, Tenoretic, Corzide, Timolide, Inderal LA 40/25, Inderide, Normozide, and the like.
Suitable statins include, but are not limited to pravastatin (e.g., Pravachol™), simvastatin (e.g., Zocor™), lovastatin (e.g., Mevacor™), and the like.
Suitable ace inhibitors include, but are not limited to captopril (e.g., Capoten™), benazepril (e.g., Lotensin™), enalapril (e.g., Vasotec™), fosinopril (e.g., Monopril™), lisinopril (e.g., Prinivil™ or Zestril™), quinapril (e.g., Accupril™), ramipril (e.g., Altace™), imidapril, perindopril erbumine (e.g., Aceon™), trandolapril (e.g., Mavik™), and the like. Suitable ARBS (Ace Receptor Blockers) include but are not limited to losartan (e.g., Cozaar™), irbesartan (e.g., Avapro™), candesartan (e.g., Atacand™), valsartan (e.g., Diovan™), and the like.
Suitable HMG CoA reductase inhibitors that are useful in accordance with the methods and compositions of the invention are statin molecules. These include: Lovastatin (e.g., Mevacor™), Pravastatin (e.g., Pravachol™), Simvastatin (e.g., Zocor™), Fluvastatin (e.g., Lescol™), Atorvastatin (e.g., Lipitor™), or Cerivastatin (e.g., Baycol™).
Other agents that may be administered in conjunction with the cochleates of the invention for treatment of atherosclerotic events and/or complications thereof are phytosterols, phytostanols and their derivatives and isomers; soy protein; soluble fibers, e.g. beta-glucan from, for example, oat and psyllium, nuts, rice bran oil, each of which is particularly suitable for use in food, dietary supplements and food additive compositions. Phytosterols may be solid (e.g., powder, granules) or liquid (e.g., oil) form.
It will be obvious to a person of skill in the art that the choice of the agent for treatment of atherosclerotic events and/or complications thereof depends on the intended delivery vehicle (e.g., food, supplement, pharmaceutical) and the mode of administration.
The cargo moiety can additionally be bound to a cochleate component or to a hydrophobic tail. In one embodiment, the cargo moiety is bound to the lipid cochleate component or the hydrophobic tail with a digestible, reducible, or otherwise reversible linker. The cargo moiety can be bound in a reversible manner e.g., with a reducible or digestible linker) or a linker susceptible to target conditions (e.g., pH, temperature, ultrasonic energy and the like). This is particularly useful as the linker can be chosen such that it is readily digestible, e.g., by an enzyme, in the body generally or even in a target structure. Thus, e.g., a linker can be chosen such that it is degraded by an enzyme in the plasma, interstitial fluids, in a cell (e.g. a macrophage) or in an endosome, such that the protonized cargo moiety becomes detached and available in unbound form in these structures. In another embodiment, the reversible linker can be an electrostatic or other bond that is broken by a change in pH, e.g., in an organ or other structure in which the cochleate experiences a pH gradient. In another embodiment, the linker is reversed by a change in temperature, e.g., by exposure to body temperature.
In one embodiment, the cargo moiety is bound by an electrostatic, hydrophobic, covalent, or ionic interaction with a lipid component such as a hydrophobic tail. In a preferred embodiment, the cargo moiety is bound to a component of the bilayer of the cochleate, e.g., a phospholipid or other lipid. Covalently binding the cargo moiety to the lipid by cross-linking can be accomplished by known methods. In one embodiment, the covalent bond is reversible so that the cargo moiety can be detached from the lipid component or hydrophobic tail under suitable conditions. For example, a cargo moiety can be attached to a phospholipid via a linker that can be cleaved by an enzyme endogenous to a target tissue, organ, or structure (e.g., a plasma protein, interstitial protein, an endosome or the intracellular milieu), such that the cargo moiety is delivered to the target tissue, organ or other structure. In alternative embodiments the cargo moiety can be attached by any other means, for example, by electrostatic interactions and/or hydrophobic interactions.
The cargo moiety can be associated with the lipid component or hydrophobic tail in any of the methods described herein. For example, in one embodiment, the cargo moiety is associated with the lipid component, such that the cargo moiety dissociates with the lipid component upon contact with a target environment. The cargo moiety can be bound to a component of the cochleate with any of the linkers described herein, e.g., a linker that is reducible, or otherwise reversible or digestible by an enzyme, protein, or molecule endogenous to the target environment. The enzyme can be an extracellular, intracellular or endosomal enzyme endogenous to the subject. In another embodiment, the cargo moiety component is electrostatically associated with the lipid component and dissociates with the cochleate upon contact with a pH gradient in a cell or organ of the subject.
Delivery of Cargo Moieties
Many naturally occurring membrane fusion events involve the interaction of calcium with negatively charged phospholipids (e.g. PS and phosphatidylglycerol). Calcium-induced perturbations of membranes containing negatively charged lipids, and the subsequent membrane fusion events, are important mechanisms in many natural membrane fusion processes. Therefore, cochleates can be envisioned as membrane fusion intermediates.
Phase/fluorescent and fluorescent images of Rhodamine-labeled cochleates incubated with splenocytes were captured and are shown in FIG. 1. These images indicate that a fusion event occurs between the outer layer of the cochleate and the cell membrane, resulting in the delivery of encochleated material into the cytoplasm of the target cell. As the calcium rich, highly ordered membrane of a cochleate first comes into close approximation to a natural membrane, a perturbation and reordering of the cell membrane is induced, resulting in a fusion event between the outer layer of the cochleate and the cell membrane. This fusion results in the delivery of a small amount of the encochleated material into the cytoplasm of the target cell. The cochleate can then break free of the cell and be available for another fusion event, either with the same or another cell.
Additionally or alternatively, particularly with active phagocytic cells, cochleates may be taken up by endocytosis and fuse from within the endocytic vesicle. Cochleates made with trace amounts of fluorescent lipids have been shown to bind and gradually transfer lipids to the plasma membrane and interior membranes of white blood cells in vitro. FIG. 33, for example, demonstrates the uptake of cochleates by macrophages.
Cochleates are useful for the delivery of a cargo moiety to cultured cells, tissues or organisms by a variety of administration routes. The term “delivery,” as used herein, refers to any means of bringing or transporting a cargo moiety to a host, a food item, a formulation, a pharmaceutical composition, or any other system, wherein the cargo moiety maintains at least a portion of its activity. For example, the use of cochleates to deliver protein or peptide molecules as vaccines has been disclosed in U.S. Pat. No. 5,840,707, issued Nov. 24, 1998. Similarly, polypeptide-cochleates are effective immunogens when administered to animals by intraperitoneal and intramuscular routes of immunization (G. Goodman-Snitkoff, et al., J. Immunol., Vol. 147, p. 410 (1991); M. D. Miller, et al., J. Exp. Med., Vol. 176, p. 1739 (1992)). Further, cochleates are effective delivery vehicles for encapsulated proteins and/or DNA to animals and to cells in culture. For example, reconstituted Sendai or influenza virus glycoproteins are efficiently delivered in encochleated form (Mannino and Gould-Fogerite, Biotechniques 6(1):682-90 (1988); Gould-Fogerite et al., Gene 84:429 (1989); Miller et al., J. Exp. Med. 176:1739 (1992)).
The cochleates can be coadministered with a further agent. The second agent can be delivered in the same cochleate preparation, in a separate cochleate preparation mixed with the cochleate preparation of the invention, separately in another form (e.g., capsules or pills), or in a carrier with the cochleate preparation. The cochleates can further include one or more additional cargo moieties, such as other drugs, peptides, nucleotides (e.g., DNA and RNA), antigens, nutrients, flavors and/or proteins.
The cochleates of the invention also can include a reporter molecule for use in in vitro diagnostic assays, which can be a fluorophore, radiolabel or imaging agent. The cochleates can include molecules that direct binding of the cochleate to a specific cellular target, or promotes selective entry into a particular cell type.
One advantage of the cochleates of the present invention is the stability of the composition. Cochleates can be administered by any route, e.g., mucosal or systemic, without concern. Cochleates can be administered orally or by instillation without concern, as well as by the more traditional routes, such as oral, intranasal, intraoculate, intrarectal, intravaginal, intrapulmonary, topical, subcutaneous, intradermal, intramuscular, intravenous, transdermal, systemic, intrathecal (into CSF), and the like. Direct application to mucosal surfaces is an attractive delivery means made possible with cochleates. Delivery can be effected by, e.g., a nasal spray or nasal bath or irrigation.
Another advantage of the present invention is the ability to modulate cochleate size. Modulation of the size of cochleates and cochleate compositions changes the manner in which the cargo moiety is taken up by cells. For example, in general, small cochleates are taken up quickly and efficiently into cells, whereas larger cochleates are taken up more slowly, but tend to retain efficacy for a longer period of time. Also, in some cases small cochleates are more effective than large cochleates in certain cells, while in other cells large cochleates are more effective than small cochleates.
Cochleates and cochleate compositions can also be administered to humans and non-human animals, such as dog, cats, and farm animals, in food or beverage preparations. Such compositions can be introduced to the food or beverage compositions by the manufacturer (e.g., to supplement food with nutrients), or by the consumer (e.g., where the cochleate composition is sold separately as a food additive). For example, nutrients and/or flavorings may be incorporated into dog or cat food, particularly where such nutrient and/or flavoring is fragile and normally decomposes or loses activity when exposed to oxygen and/or water. Cochleates may be added at any stage into the preparation of dog or cat food, as the cochleates are stable under extreme pressure and temperature conditions.
Another advantage of cochleates and cochleate compositions of the present invention is their ability to reduce a number of unwanted side effects. A number of drugs currently on the market cause gastrointestinal distress and often high circulating blood levels lead to toxicity in a number of vital organs. The ingestion of, e.g., aspirin may result in epigastric distress, nausea, and vomiting. Aspirin may also cause gastric ulceration; exacerbation of peptic ulcer symptoms, gastrointestinal hemorrhage, and erosive gastritis have all been reported in patients on high-dose therapy but also may occur even when low doses are administered. In high doses, aspirin can also cause hepatic injury. Aspirin can cause retention of salt and water as well as an acute reduction of renal function in patients with congestive heart failure or renal disease. Although long-term use of aspirin alone rarely is associated with nephrotoxicity, the prolonged and excessive ingestion of aspirin in combination with other compounds can produce papillary necrosis and interstitial nephritis. Although acetaminophen is usually well tolerated, skin rash (generally erythematous or urticarial) and other allergic reactions occur occasionally. Occasionally, the rash can be more serious and may be accompanied by drug fever and mucosal lesions. In other examples, the use of acetaminophen has been associated with neutropenia, thrombocytopenia, and pancytopenia. The most serious adverse effect of acute overdosage of acetaminophen is a dose-dependent, potentially fatal hepatic necrosis. Renal tubular necrosis and hypoglycemic coma also may occur.
Another advantage of the present invention is that the cochleates can be formulated for uptake by particular cells or organs. Conventionally, high levels of drugs are often administered intravenously to obtain moderate levels at the sites of infection in order to combat opportunistic infections. This can cause undesirable side effects, for example, in the case of vancomycin, macular skin rashes, anaphylaxis, phlebitis and pain at the site of intravenous injection, chills, rash, and fever may occur. Also, rapid intravenous infusion may cause a variety of symptoms, including erythematous or urticarial reactions, flushing, tachycardia, and hypotension, generally non-permanent auditory impairment, ototoxicity associated with excessively high concentrations of the drug in plasma and less commonly, nephrotoxicity. By employing the cochleates of the present invention, toxicity levels can be lowered by decreasing the free drug in the circulating blood. Additionally, the cargo moiety can be delivered directly to the site of infection, which can lower or eliminate the incidence of gastrointestinal distress.
Aminoglycosides are very poorly absorbed from the gastrointestinal tract. Less than 1% of the dose typically is absorbed following either oral or rectal administration. Also, inadequate concentrations of aminoglycosides are found in cerebrospinal fluid. Additionally, the drugs are not inactivated in the intestine, and are excreted relatively rapidly by the normal kidney, i.e., they are eliminated quantitatively in the feces. Long-term oral or rectal administration, however, may result in accumulation of aminoglycosides to toxic concentrations in patients with renal impairment. Instillation of these drugs into body cavities with serosal surfaces may result in rapid absorption and unexpected toxicity, i.e., neuromuscular blockade. Similarly, intoxication may occur when aminoglycosides are applied topically for long periods to large wounds, burns, or cutaneous ulcers, particularly if there is renal insufficiency.
Moreover, due to their polar nature, aminoglycosides largely are excluded from most cells, from the central nervous system, and from the eye. Concentrations of conventionally administered aminoglycosides in secretions and tissues are low. High concentrations, however, are found in the renal cortex and in the endolymph and perilymph of the inner ear; this is thought to contribute to the nephrotoxicity and ototoxicity caused by these drugs. Although they are widely used agents, serious toxicity is a major limitation to the usefulness of the aminoglycosides.
Both vestibular and auditory dysfunction can follow the administration of any of the aminoglycosides. Studies of both animals and human beings have documented progressive accumulation of these drugs in the perilymph and endolymph of the inner ear. Accumulation occurs predominantly when plasma concentrations are high. Diffusion back into the bloodstream is slow; the half-lives of the aminoglycosides are five to six times longer in the otic fluids than in plasma. Ototoxicity is more likely to occur in patients with persistently elevated concentrations of drug in plasma. However, even a single dose of tobramycin has been reported to produce slight temporary cochlear dysfunction during periods when the concentration in plasma is at its peak. The relationship of this observation to permanent loss of hearing is not known.
Approximately 8% to 26% of patients who receive an aminoglycoside for more than several days develop renal impairment, which is almost always reversible. The toxicity results from accumulation and retention of aminoglycoside in the proximal tubular cells. The initial manifestation of damage at this site is excretion of the enzymes of the renal tubular brush border. Several variables have been found to influence nephrotoxicity from aminoglycosides, including total amount of drug administered and duration of therapy. Constant concentrations of drug in plasma above a critical level, which is manifested by elevated trough serum concentrations, correlate with toxicity in human beings. Aminoglycosides have the potential to produce reversible and irreversible vestibular, cochlear, and renal toxicity. These side effects complicate the use of these compounds and make their proper administration difficult.
Accordingly, the cochleates of the present invention can be employed to avoid harmful side effects of drugs caused by their high concentration or presence in organs such as the kidneys, stomach or liver.
Echinocandins are a relatively new class of antifungal drugs. Although the most widely known echinocandin, caspofungin, is considered less toxic than other antifungal drugs, (e.g., Amphotericin B), this is not true of the entire class. Caspofungin is especially effective against Candida species, however, other members of the echinocandin class have activity against other species, (e.g., Cryptococcus). Additionally, echinocandins are generally administered intravenously due to their poor oral absorption. Cochleates of the present invention can be used not only to facilitate oral absorption, but also to avoid potential side effects from this class of compounds.
Safety/Biocompatibility
Cochleates readily can be prepared from safe, simple, well-defined, naturally occurring substances, e.g., PS and calcium. Mixtures of naturally occurring (e.g., soy lipids), synthetic lipids, and/or modified lipids can also be utilized. Phosphatidylserine is a natural component of all biological membranes, and is most concentrated in the brain. The phospholipids used can be produced synthetically, or prepared from natural sources. Soy PS is inexpensive, available in large quantities and suitable for use in humans. Clinical studies indicate that PS is safe and may play a role in the support of mental functions in the aging brain. Unlike many cationic lipids, cochleates (which are composed of anionic lipids) are non-inflammatory and biodegradable. The tolerance in vivo of mice to multiple administrations of cochleates by various routes, including intravenous, intraperitoneal, intranasal and oral, has been evaluated. Multiple administrations of high doses of cochleate formulations to the same animal show no toxicity, and do not result in either the development of an immune response to the cochleate matrix, or any side effects relating to the cochleate vehicle.
The cochleates and cochleate compositions of the present invention can be administered to animals, including both human and non-human animals. It can be administered to animals, e.g., in animal feed or water. For example, antibiotic-cochleates of the present invention can be administered to poultry and other farm animals, including the ruminants and pigs, to control infection or to promote growth or milk production. Among a number of conditions which can be treated with these agents is enteritis, a disease which can cause severe economic losses to livestock producers. Enteritis occurs in chickens, swine, cattle and sheep and is attributed mainly to anaerobic bacteria, particularly Clostridium perfungens. Enterotoxemia in ruminants, an example of which is “overeating disease” in sheep, is a condition caused by C. perfungens infection. The treatment of such conditions is therefore also encompassed within the methods of the present invention.
Methods of Treatment
In yet another aspect, the present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder which can be treated with one or more cargo moiety.
“Treatment”, or “treating” as used herein, is defined as the application or administration of a therapeutic agent (e.g., antibiotics encochleated by cochleates of the invention) to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has a disease or disorder, a symptom of disease or disorder or a predisposition toward a disease or disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease or disorder, the symptoms of the disease or disorder, or the predisposition toward disease or disorder. “Treated,” as used herein, refers to the disease or disorder being cured, healed, alleviated, relieved, altered, remedied, ameliorated improved or affected. For example, certain methods of treatment of the instant invention provide for administration of anti-inflammatory cochleates, such that inflammation is lessened or alleviated. Other methods of treatment of the instant invention include the administration of antifungal cochleates, such that fungal infection is relieved or remedied.
The terms “cure,” “heal,” “alleviate,” “relieve,” “alter,” “remedy,” “ameliorate,” “improve” and “affect” are evaluated in terms of a suitable or appropriate control. A “suitable control” or “appropriate control” is any control or standard familiar to one of ordinary skill in the art useful for comparison purposes. In one embodiment, a “suitable control” or “appropriate control” is a value, level, feature, characteristic, property, etc. determined prior to administration of a cargo moiety cochleate, as described herein. For example, the number of colony forming units can be determined prior to administering an echinocandin cochleate of the invention to a host. In another embodiment, a “suitable control” or “appropriate control” is a value, level, feature, characteristic, property, etc. determined in a subject, e.g., a control or normal subject exhibiting, for example, normal traits. In yet another embodiment, a “suitable control” or “appropriate control” is a predefined value, level, feature, characteristic, property, etc.
The methods of the present invention include methods of administering a cargo moiety to a host, wherein the cargo moiety is associated with a cochleate or cochleate composition of the invention. The cochleates and cochleate compositions of the present invention may be administered orally, nasally, topically, intravenously, transdermally, buccally, sublingually, rectally, vaginally or parenterally.
The present invention provides a method for treating a subject that would benefit from administration of a composition of the present invention. Any therapeutic indication that would benefit from a cargo moiety, e.g., a drug or nutrient, can be treated by the methods of the invention. Accordingly, the present invention provides methods of treating a subject at risk for or having a disease or disorder which can be treated with, for example, a protein, a small peptide, a bioactive polynucleotide, an antibiotic, an antiviral, an anesthetic, antipsychotic, an anti-infectious, an antifungal, an anticancer, a immunosuppressant, an immunostimulant, a steroidal anti-inflammatory, a non-steroidal anti-inflammatory, an antioxidant, an antidepressant which can be synthetically or naturally derived, a substance which supports or enhances mental function or inhibits mental deterioration, an anticonvulsant, an HIV protease inhibitor, a non-nucleophilic reverse transcriptase inhibitor, a cytokine, a tranquilizer, a mucolytic agent, a dilator, a vasoconstrictor, a decongestant, a leukotriene inhibitor, an anti-cholinergic, an anti-histamine, a cholesterol lipid metabolism modulating agent or a vasodilatory agent. The method includes the step of administering to the subject a composition of the invention, such that the disease or disorder is treated. The disease or disorder can be, e.g., inflammation, pain, infection, fungal infection, bacterial infection, viral infection, parasitic disorders, an immune disorder, genetic disorders, degenerative disorders, cancer, proliferative disorders, obesity, depression, hair loss, impotence, hypertension, hypotension, dementia, senile dementia, or malnutrition, acute and chronic leukemia and lymphoma, sarcoma, adenoma, carcinomas, epithelial cancers, small cell lung cancer, non-small cell lung cancer, prostate cancer, breast cancer, pancreatic cancer, hepatocellular carcinoma, renal cell carcinoma, biliary cancer, colorectal cancer, ovarian cancer, uterine cancer, melanoma, cervical cancer, testicular cancer, esophageal cancer, gastric cancer, mesothelioma, glioma, glioblastoma, pituitary adenomas, schizophrenia, obsessive compulsive disorder (OCD), bipolar disorder, Alzheimer's disease, Parkinson's disease, cell proliferative disorders, blood coagulation disorders, Dysfibrinogenaemia and hemophilia (A and B), autoimmune disorders, e.g., systemic lupus erythematosis, multiple sclerosis, myasthenia gravis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, Grave's disease, allogenic transplant rejection, ankylosing spondylitis, psoriasis, scleroderma, uveitis, eczema, dermatological disorders, hyperlipidemia, hyperglycemia, and hypercholesterolemia.
Cochleates of the instant invention can also be used to promote greater health or quality of life, for example limit cholesterol uptake or regulate lipid metabolism, weight gain, hunger, aging, or growth. Cosmetic effects such as wrinkle reduction, hair growth, pigmentation, or dermatologic disorders may also be treated. Cochleates may also treat hereditary disease such as cystic fibrosis or muscular dystrophy.
The cochleates of the instant invention can be used to treat a variety of inflammations, including headache, arthritis, rheumatoid arthritis, osteoarthritis, atherosclerosis, acute gout, acute or chronic soft tissue damage associated with, e.g., a sports injury, tennis elbow, bursitis, tendonitis, acute or chronic back pain, such as a herniated disc, carpal tunnel syndrome, glomerulonephritis, carditis, ulcerative colitis, asthma, sepsis, and plantar fasciitis. The cochleates of the invention can also be used to relieve pain resulting from surgery or other medical procedure. The cochleates of the instant invention can further be used to treat a variety of fungal infections, including candida, e.g., yeast infection, tinea, e.g., Athlete's foot, pityriasis, thrush, cryptococcal meningitis, histoplasmosis, and blastomycosis.
The cochleates of the instant invention can also be used to treat a variety of bacterial infections, including but not limited to moderate to severe lower respiratory tract infections, skin infections, biliary tract infections, bone infections, antibiotic prophylaxis, pseudomembranous enterocolitis, central nervous system infections (e.g., meningitis and ventriculitis), intra-abdominal infections (e.g., peritonitis), pneumonia, septicemia, soft tissue infections, neutropenic sepsis, joint infections, infective endocartidis, and urinary tract infections.
Exemplary bacteria that can be treated with the antibiotic preparation of the present invention include, but are not limited to, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, Streptococcus pneumuoniae, Streptococcus Group D, Clostridium perfungens, Haemophilus influenzae, Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae.
The cochleate compositions of the invention are demonstrated herein to effectively mediate the presence of bacteria such as Pseudomona and Staphylococcus. One species, S. aureus, one of the leading causes of hospital acquired infections, causes a wide variety of suppurative diseases, including superficial and deep abscesses, empyema, meningitis, purulent arthritis, and septicemia and endocarditis. In addition, it causes two toxinoses: food poisoning and exfolative skin disease.
Staphyloccoci found in infected tissues are mainly located extracellularly. However, virulent staphylococci can survive within leukocytes after phagocytosis and may protect themselves against the bactericidal action of antibiotics by means of their intracellular location. Intraphagocytic survival of S. aureus has also been observed in patients with various disorders of phagocytic functions. Certain infections caused by S. aureus have the tendency to become recurrent, which is attributable to the intraphagocytic survival of small numbers of the organism. Antibiotics that are able to penetrate leukocytes have been shown to have superior clinical efficacy in such recurrent and persistent staphylococcal infections.
Because intracellular residence of infectious agents can complicate treatment, a complete cure can require the eradication of all intracellular bacteria. Therefore, a therapeutic approach that increases the intracellular antibiotic concentration may enhance the bactericidal killing and ensure complete elimination of infection.
Pseudomonas aeruginosa infections occur in individuals with altered host defenses, including burn patients, persons with malignant or metabolic disease, or those who have had prior instrumentation or manipulation. Prolonged treatment with immunosuppressive or antimicrobial drugs and radiation therapy also predispose individuals to Pseudomonas infections. P. aeruginosa is a frequent cause of life-threatening infection, and is the most common cause of nosocomial gram-negative pneumonia, with an associated mortality rate of less than 60%. Among immunocompromised patients, P. aeruginosa is a frequent cause of nosocomial bacteremia. In cystic fibrosis, P. aeruginosa chronically colonizes the lung, eventually causing respiratory failure and death.
In a preferred embodiment, antibacterial cochleates of the present invention have the ability to reduce the number of bacterial colonies by at least 10%. More preferably, antibacterial cochleates can reduce the number of bacterial colonies by at least 25% and even more preferably by 50%, 75%, 85%, 95%, . . . 100%. All individual values and ranges falling between these ranges and values are within the scope of the present invention.
The present invention also provides a means for treating a variety of fungal infections, including, but not limited to, asthma, chronic rhinosinusitis, allergic fungal sinusitis, sinus mycetoma, non-invasive fungus induced mucositis, non-invasive fungus induced intestinal mucositis, chronic otitis media, chronic colitis, inflammatory bowel diseases, ulcerative colitis, Crohn's disease, candidemia, intraabdominal abscesses, peritonitis, pleural space infections, esophageal candidiasis and invasive aspergillosis. Exemplary fungi that can be treated using antifungal cochleates of the invention include, without limitation, Absidia, Aspergillus flavus, Aspergillus fumigatus, Aspergillus glaucus, Aspergillus nidulans, Aspergillus terreus, Aspergillus versicolor, Alternaria, Basidiobolus, Bipolaris, Candida albicans, Candida glabrata, Candida guilliermondii, Candida krusei, Candida lypolytica, Candida parapsilosis, Candida tropicalis, Cladosporium, Conidiobolus, Cunninahamella, Curvularia, Dreschlera, Exserohilum, Fusarium, Malbranchia, Paecilonvces, Penicillium, Pseudallescheria, Rhizopus, Schizophylum, Sporothrix, Acremonium, Arachniotus citrinus, Aurobasidioum, Beauveria, Chaetomium, Chryosporium, Epicoccum, Exophilia jeanselmei, Geotrichum, Oidiodendron, Phoma, Pithomyces, Rhinocladiella, Rhodoturula, Sagrahamala, Scolebasidium, Scopulariopsis, Ustilago, Trichoderma, and Zygomycete.
Candida albicans is part of the normal microbial flora that colonizes mucocutaneous surfaces of the oral cavity gastrointestinal tract, and vagina of many mammals and birds. Because both antibody- and cell-mediated immune responses to Candida antigens are evoked in healthy individuals, C. albicans colonies are generally infectious for the host. C. albicans, however, does not normally cause disease in immunocompetent colonized hosts. It is the setting of congenital, induced, or disease-related immune dysfunction that C. albicans causes cutaneous, mucocutaneous, and life-threatening systemic disease.
C. albicans is able to not only compete with other microbes but also adhere to and survive on mucosal surfaces of a host with Candida-specific antibody and cell-mediated immunity. Numerous putative C. albicans virulence factors exist that may enable this opportunistic fungus to survive and thrive in the adverse conditions of host tissues. Among these putative virulence factors, the cell wall of C. albicans is one of the most important. The cell wall provides rigidity as well as protection against osmotic lysis, and it promotes infection by supporting the interaction of C. albicans adhesins and host-cell receptors. Also, the C. albicans cell wall contains mannoproteins which have immunosuppressive properties that can enhance the persistence of the fungus in lesions. Echinocandins, unlike other antifungals, function by interfering with the synthesis of the fungal cell wall.
In a preferred embodiment, echinocandin cochleates of the present invention have the ability to reduce fungal colony forming units (CFU's) by at least 10%. More preferably, echinocandin cochleates can reduce CFU's by at least 25% and even more preferably by 50%, 75%, 85%, 95%, . . . 100%. All individual values and ranges falling between these ranges and values are within the scope of the present invention. Reduction in colony forming units may be in vivo or in vitro. The host of the fungal infection can be a human or non-human animal.
Macrophages are important in the uptake of bacteria, fungi and parasites, and also play an important role in the inflammatory response. In addition to performing phagocytosis, macrophages have the potential of being activated, a process that results in increased cell size, increased levels of lysosomal enzymes, more active metabolism, and greater ability to phagocytose and kill ingested microbes. After activation, macrophages secrete a wide variety of biologically active products that, if unchecked, result in tissue injury and chronic inflammation. One of the secreted products, nitric oxide (NO) has come into the forefront as a mediator of inflammation.
Nitric oxide (NO) produced by inducible NOS plays an important role in inflammation, killing of bacterial pathogens, and tissue repair. NO formation increases during inflammation (i.e., in rheumatoid arthritis, ulcerative colitis, and Crohns disease), and several classic inflammatory symptoms, (i.e., erythema and vascular weakness) are reversed by NOS inhibitors. Nitric oxide has also been recognized as playing a versatile role in the immune system. It is involved in the pathogenesis and control of infectious diseases, tumors, autoimmune processes and chronic degenerative diseases.
Aspirin and acetaminophen are used as anti-inflammatory drugs to relieve pain and fever. The mechanism of action and side effects of these drugs are explained in part by the generation of NO from iNOS. Inhibition of iNOS expression and NO production, therefore, could be a way to therapeutically decrease the inflammatory actions of these drugs.
The above methods can be employed in the absence of other treatment, or in combination with other treatments. Such treatments can be started prior to, concurrent with, or after the administration of the compositions of the instant invention. Accordingly, the methods of the invention can further include the step of administering a second treatment, such as for example, a second treatment for the disease or disorder or to ameliorate side effects of other treatments. Such second treatment can include, e.g., radiation, chemotherapy, transfusion, operations (e.g., excision to remove tumors), and gene therapy. Additionally or alternatively, further treatment can include administration of drugs to further treat the disease or to treat a side effect of the disease or other treatments (e.g., anti-nausea drugs).
With regard to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. “Pharmacogenomics”, as used herein, refers to the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market.
More specifically, the term refers the study of how a patient's genes determine his or her response to a drug (e.g., a patient's “drug response phenotype”, or “drug response genotype”). Thus, another aspect of the invention provides methods for tailoring an individual's prophylactic or therapeutic treatment according to that individual's drug response genotype. Pharmacogenomics allows a clinician or physician to target prophylactic or therapeutic treatments to patients who will most benefit from the treatment and to avoid treatment of patients who will experience toxic drug-related side effects.
The language “therapeutically effective amount” is that amount necessary or sufficient to produce the desired physiologic response. The effective amount may vary depending on such factors as the size and weight of the subject, or the particular compound. The effective amount may be determined through consideration of the toxicity and therapeutic efficacy of the compounds by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it may be expressed as the ratio LD50/ED50. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to unaffected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any composition used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 (i.e., the concentration of the test composition that achieves a half-maximal response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
1. Prophylactic Methods
In one aspect, the invention provides a method for preventing in a subject, a disease or disorder which can be treated with at least one cargo moiety, e.g., a protein, a small peptide, an antiviral, an anesthetic, an anti-infectious, an antifungal, an anticancer, an immunosuppressant, a steroidal anti-inflammatory, a non-steroidal anti-inflammatory, a tranquilizer, a mucolytic agent, a dilator, a vasoconstrictor, a decongestant, a leukotriene inhibitor, an anti-cholinergic, an anti-histamine or a vasodilatory agent. Subjects at risk for a disease or condition which can be treated with the agents mentioned herein can be identified by, for example, any or a combination of diagnostic or prognostic assays known to those skilled in the art. Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented or, alternatively, delayed in its progression. Amphotericin B cochleates, for example, have been administered prophylactically in mice, and were at least as efficacious, if not more efficacious, than Amphotericin B deoxycholate.
2. Therapeutic Methods
Another aspect of the invention pertains to methods of administering a cochleate composition for therapeutic purposes. In one embodiment, the present invention provides a method for treating a subject that would benefit from administration of a composition of the present invention. Any therapeutic indication that would benefit from a cochleate composition of the invention can be treated by the methods of the invention. The present invention provides methods of treating a subject at risk for or having a disease or disorder that can be treated with one or more cargo moiety. The method includes the step of administering to the subject a composition of the invention, such that the disease or disorder is prevented, ameliorated, terminated or delayed in its progression. The disease or disorder can be any of the diseases or disorders discussed herein.
The compositions of the invention can be administered to a subject alone or in combination with a second therapy as described above. The compositions of the invention can be administered to a subject prior to, at the same time, or after a second therapy is administered.
Therapeutic agents can be tested in an appropriate animal model. For example, cochleate compositions of the present invention can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with said agent. Alternatively, a therapeutic agent can be used in an animal model to determine the mechanism of action of such an agent. For example, an agent can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent can be used in an animal model to determine the mechanism of action of such an agent.
Pharmaceutical Compositions
The invention pertains to uses of the cochleate compositions of the invention for prophylactic and therapeutic treatments as described infra. Accordingly, the compounds of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the compositions of the invention and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art.
Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants may also be present in the compositions.
Examples of pharmaceutically acceptable antioxidants, which may also be present in formulations of therapeutic compounds of the invention, include water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
Furthermore, the present invention can further include one or more additional agents, including water, antimicrobial agents, plasticizing agents, flavoring agents, surfactants, stabilizing agents, emulsifying agents, thickening agents, binding agents, coloring agents, sweeteners, fragrances, and the like.
Suitable antimicrobial agents include triclosan, cetyl pyridium chloride, domiphen bromide, quaternary ammonium salts, zinc compounds, sanguinarine, fluorides, alexidine, octonidine, EDTA, and essential oils such as thymol, methyl salicylate, menthol and eucalyptol.
Suitable plasticizing agents include, for example, polyols such as sugars, sugar alcohols, or polyethylene glycols (PEGs), urea; glycol, propylene glycol, triethyl citrate, dibutyl or dimethyl phthalate, monoacetin, diacetin or triacetin.
Suitable surfactants include pluronic acid, sodium lauryl sulfate, mono and diglycerides of fatty acids and polyoxyethylene sorbitol esters, such as, Atmos 300 and Polysorbate 80. Suitabie stabilizing agents include xanthan gum, locust bean gum, guar gum, and carrageenan. Suitable emulsifying agents include triethanolamine stearate, quaternary ammonium compounds, acacia, gelatin, lecithin, bentonite, veegum, and the like. Suitable thickening agents include methylcellulose, carboxyl methylcellulose, and the like. Suitable binding agents include starch.
Suitable sweeteners that can be included are those well known in the art, including both natural and artificial sweeteners. Suitable sweeteners include water-soluble sweetening agents such as monosaccharides, disaccharides and polysaccharides; water-soluble artificial sweeteners such as soluble saccharin salts, cyclamate salts, or the free acid form of saccharin, and the like; dipeptide based sweeteners, such as L-aspartic acid derived sweeteners; water-soluble sweeteners derived from naturally occurring water-soluble sweeteners, such as a chlorinated derivative of ordinary sugar (sucrose), known, under the product description of sucralose; and protein based sweeteners such as thaumatoccous danielli (Thaumatin I and II).
In general, an effective amount of auxiliary sweetener is utilized to provide the level of sweetness desired for a particular composition, and this amount will vary with the sweetener selected. This amount will normally be 0.01% to about 10% by weight of the composition when using an easily extractable sweetener.
The flavorings that can be used include those known to the skilled artisan, such as natural and artificial flavors. These flavorings may be chosen from synthetic flavor oils and flavoring aromatics, and/or oils, oleo resins and extracts derived from plants, leaves, flowers, fruits and so forth, and combinations thereof. Representative flavor oils include: spearmint oil, cinnamon oil, peppermint oil, clove oil, bay oil, thyme oil, cedar leaf oil, oil of nutmeg, oil of sage, and oil of bitter almonds. Also useful are artificial, natural or synthetic fruit flavors such as vanilla, chocolate, coffee, cocoa and citrus oil, and fruit essences. These flavorings can be used individually or in admixture. Flavorings such as aldehydes and esters including cinnamyl acetate, cinnamaldehyde, citral, diethylacetal, dihydrocarvyl acetate, eugenyl formate, p-methylanisole, and so forth may also be used. Generally, any flavoring or food additive, such as those described in Chemicals Used in Food Processing, publication 1274 by the National Academy of Sciences, pages 63-258, may be used.
The amount of flavoring employed is normally a matter of preference subject to such factors as flavor type, individual flavor, and strength desired. Thus, the amount may be varied in order to obtain the result desired in the final product. Such variations are within the capabilities of those skilled in the art without the need for undue experimentation.
The compositions of this invention can also contain coloring agents or colorants. The coloring agents are used in amounts' effective to produce the desired color. The coloring agents useful in the present invention include pigments such as titanium dioxide, which may be incorporated in amounts of up to about 5 wt %, and preferably less than about 1 wt %. Colorants can also include natural food colors and dyes suitable for food, drug and cosmetic applications. These colorants are known as FD&C dyes and lakes. A full recitation of all FD&C and D&C dyes and their corresponding chemical structures may be found in the Kirk-Othmer Encyclopedia of Chemical Technology, Volume 5, Pages 857-884, which text is accordingly incorporated herein by reference.
Formulations of the present invention include those suitable for oral, nasal, topical, transdermal, buccal, sublingual, rectal, vaginal or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which may be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of 100%, this amount will range from about 1% to about 99% of active ingredient preferably from about 5% to about 70%, most preferably from about 10% to about 30%.
Methods of preparing these formulations or compositions include the step of bringing into association a composition of the present invention with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a composition of the present invention with liquid carriers, or finely divided solid carriers, or both, and then if necessary, shaping the product.
Formulations of the invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, gelcaps, crystalline substances, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, gel, partial liquid, spray, nebulae, mist, atomized vapor, aerosol, tincture, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) or as mouth washes and the like, each containing a predetermined amount of a composition of the present invention as an active ingredient. A composition of the present invention may also be administered as a bolus, electuary, or paste.
In solid dosage forms of the invention for oral administration (capsules, tablets, pills, dragees, powders, granules, and the like), the active ingredient is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, or any of the following: fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, or silicic acid; binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose or acacia; humectants, such as glycerol; disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; solution retarding agents, such as paraffin; absorption accelerators, such as quaternary ammonium compounds; wetting agents, such as, for example, cetyl alcohol and glycerol monostearate; absorbents, such as kaolin and bentonite clay; lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl-sulfate, and mixtures thereof; and coloring agents.
In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing-agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered composition moistened with an inert liquid diluent.
The tablets, and other solid dosage forms of the pharmaceutical compositions of the present invention, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes or microspheres.
They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which may be dissolved in sterile water, or some other sterile injectable medium immediately before use.
These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which may be used include polymeric substances and waxes. The active ingredient may also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
Liquid dosage forms for oral administration of the compounds of the invention include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert dilutents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert dilutents, the oral compositions may also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
Formulations of the pharmaceutical compositions of the invention for rectal or vaginal administration may be presented in liquid or aerosol form, or as a suppository, which may be prepared by mixing one or more compounds of the invention with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound. Liquid or aerosol forms include, but are not limited to, gels, pastes, ointments, salves, creams, solutions, suspensions, partial liquids, sprays, nebulaes, mists, atomized vapors, and tinctures. Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
Formulations of the pharmaceutical compositions of the invention for nasal administration can be in solid, liquid, or aerosol form (e.g., powder, crystalline substance, gel, paste, ointment, salve, cream, solution, suspension, partial liquid, spray, nebulae, irrigant, wash, mist, atomized vapor or tincture).
Dosage forms for the topical or transdermal administration of a composition of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The composition may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
The ointments, pastes, creams and gels may contain, in addition to an composition of this invention, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
Powders and sprays may contain, in addition to a composition of this invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays may additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
Transdermal patches have the added advantage of providing controlled delivery of a composition of the present invention to the body. Such dosage forms may be made by dissolving or dispersing the composition in the proper medium. Absorption enhancers may also be used to increase the flux of the composition across the skin. The rate of such flux may be controlled by either providing a rate controlling membrane or dispersing the composition in a polymer matrix or gel.
Ophthalmic formulations, eye ointments, powders, solutions and the like are also within the scope of this invention.
Pharmaceutical compositions of this invention suitable for parenteral administration comprise a cochleate or cochleate composition of the invention in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity may be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, and sodium chloride, in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating a composition of the invention in the desired amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the composition into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the cochleate compositions of the invention plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Injectable depot forms are made by forming microencapsule matrices of the subject compounds in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release may be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.
Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the composition can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the composition in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal-administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
The compositions of the invention also can be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
In one embodiment, the compositions of the invention are prepared with carriers that will protect the composition against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of a composition calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the composition and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such a composition for the treatment of individuals.
The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
The pharmaceutical compositions can be included in a container along with one or more additional compounds or compositions and instructions for use. For example, the invention also provides for packaged pharmaceutical products containing two agents, each of which exerts a therapeutic effect when administered to a subject in need thereof. A pharmaceutical composition may also comprise a third agent, or even more agents yet, wherein the third (and fourth, etc.) agent can be another agent against the disorder, such as a cancer treatment (e.g., an anticancer drug and/or chemotherapy) or an HIV cocktail. In some cases, the individual agents may be packaged in separate containers for sale or delivery to the consumer. The agents of the invention may be supplied in a solution with an appropriate solvent or in a solvent-free form (e.g., lyophilized). Additional components may include acids, bases, buffering agents, inorganic salts, solvents, antioxidants, preservatives, or metal chelators. The additional kit components are present as pure compositions, or as aqueous or organic solutions that incorporate one or more additional kit components. Any or all of the kit components optionally further comprise buffers.
The present invention also includes packaged pharmaceutical products containing a first agent in combination with (e.g., intermixed with) a second agent. The invention also includes a pharmaceutical product comprising a first agent packaged with instructions for using the first agent in the presence of a second agent or instructions for use of the first agent in a method of the invention. The invention also includes a pharmaceutical product comprising a second or additional agents packaged with instructions for using the second or additional agents in the presence of a first agent or instructions for use of the second or additional agents in a method of the invention. Alternatively, the packaged pharmaceutical product may contain at least one of the agents and the product may be promoted for use with a second agent.
In yet another aspect, the invention provides an article of manufacture of cochleates and/or cochleate compositions of the invention (FIG. 29). The article of manufacture includes packaging material and a lipid contained within the packaging material. The packaging material includes a label or package insert indicating the use of the lipid for forming cochleates or cochleate compositions of the invention. The article of manufacture can further include instructions or guidelines for the formation of cochleates or cochleate compositions of the invention, e.g., mixing a cargo moiety with a solvent and dripping it into a solution of the lipids. Optionally, the article of manufacture can include a solvent, a cargo moiety, a multivalent cation (e.g., calcium and/or magnesium), a control cargo moiety, and/or a chelating agent (e.g., EDTA).
The article of manufacture may further include other ingredients or apparatus that can be employed to manufacture the compositions of the present invention. One non-limiting example of an article of manufacture would include 5 g of powdered Soy PS, a solution of a model hydrophobic compound in DMSO as a positive control, a solution of calcium chloride to induce cochleate formation, and a solution of EDTA to visualize the opening of the cochleates into liposomes.
The instructions and/or guidelines may generally include one or more of the following statements:
1. Prepare a liposomal suspension by vigorously mixing lipid in water or buffer.
2. Monitor lipid concentrations: low concentration would require a large volume of buffer in order to formulate an adequate amount of end product and high concentration may produce large cochleate aggregates upon the addition of calcium.
3. Experimentally determine whether to use water or buffered solution: the presence of salts and the pH of the suspension may affect the formation of the cargo moiety-liposome intermediate depending on the properties of the cargo moiety.
4. Optionally filter or perform other standard procedures to prepare liposomes of defined size and/or to sterilize the suspension.
5. Prepare a cargo moiety solution with an appropriate solvent: many solvents may potentially be used in this process, e.g., DMSO.
6. Add the cargo moiety-solvent solution, preferably dropwise, to the liposome suspension with vigorous mixing.
7. Experimentally determine the optimal rate of addition and speed of mixing: a suspension of cargo Moiety-liposomes essentially free of unencochleated cargo moiety when viewed by light microscopy should be produced.
8. Calculate the amount of calcium to be added by assuming one mole of calcium for every two moles of lipid, and adding extra calcium to bring the buffer to between 2 and 6 mM.
9. Induce cochleate formation through addition of a calcium salt. The salt may be added as a solution, e.g., 0.1 M calcium chloride, or may be slowly added as a solid calcium salt, e.g., calcium chloride, with vigorous mixing.
10. If the presence of solvent in the buffer is unwanted, optionally harvest the cargo moiety-cochleates, e.g., by centrifugation or filtration, and resuspending them in an appropriate medium. The association of calcium ions with PS is easily reversible, therefore, in order to remain intact and in their crystalline state, cochleate formulations can be resuspended in a medium containing at least 1 to 2 mM calcium ions.
11. Optionally evaluate the quality of the cochleate formulation. The presence of sufficient calcium ions initiates and maintains the cochleate structure. One method of evaluating the quality of a cochleate formulation is visualization of the liposomes that are produced upon removal of the calcium ions from a cochleate crystal. This may be accomplished using light microscopy. An aliquot of a cargo moiety-cochleate suspension may be visualized by phase contrast microscopy at 1000× magnification. A small amount of a concentrated solution of a chelating agent, e.g., EDTA, may be added to the edge of the cover slip, thus reaching the sample through capillary action. A high-quality cochleate product will open into intact liposomes upon contact with the calcium-chelating agent. When using EDTA as the chelating agent, the pH of the EDTA solution should be about pH 9.5. Cochleates will not convert to liposomes at a pH below 6.5. If EDTA solutions at pH 7.4 are used, the release of hydrogen ions upon the binding of calcium to the acetate groups of the chelating agent lowers the pH of the solution and inhibits cochleate conversion to liposomes.
Choice of solvent and other materials, optimal rate of dropwise addition, speed of mixing, the amount of calcium, etc., can readily be determined by the skilled practitioner employing the teachings provided herein.
In addition, a skilled practitioner can introduce, modify and/or eliminate elements and/or steps to the above without departing from the scope of the invention. For example, a liposome suspension might be provided already prepared, a combination of solvents might be used, excess calcium might be used to obviate the calculation of calcium, alternative or additional cations might be employed, etc.
Practice of the invention will be still more fully understood from the following examples, which are presented herein for illustration only and should not be construed as limiting in any way.
EXEMPLIFICATION
Materials and Methods
Materials
The following materials were used, unless otherwise indicated: powdered Amphotericin B (AmB) U.S. Pharmacopela grade was obtained from USP (Rockville, Md.) and Alpharma (Copenhagen, Denmark), and stored at 4° C.; powdered Soy PS was obtained from American Lethicin Corporation (Oxford, Conn.) and Degussa (Champaign, Ill.) and stored at room temperature; Vitamin E (V-E) was obtained from Roche (Parsippany, N.J.); sterile water was obtained from Baxter (Canada); Dioleoylphosphatidyl serine (DOPS) was obtained from Avanti Polar Lipid (Alabaster, Ala.), methyl sulfoxide (DMSO)HPLC grade was obtained from Aldrich (Milwaukee, Wis.), and, micellar AmB/deoxycholate suspension sold under the trademark FUNGIZONE was obtained from Sigma (St. Louis, Mo.).
General Method for Forming Cochleates with a Cargo Moiety
Lipid powder (soy PS or synthetic PS) is dispersed in water (pure water or saline) by vortexing, resulting mixture of unilamellar and multilamellar liposomes. The liposomal suspension is filtered to obtain a suspension having a majority of unilamellar liposomes. To this liposome suspension, a water miscible organic solvent (e.g., DMSO) including a cargo moiety (and optional antioxidant) is introduced. The liposomal suspension is precipitated with cation. The solvent may be removed from the liposomal suspension by tangential flow and/or filtration and/or dialysis, or from the cochleates by washing, filtration, centrifugation, tangential flow, and/or dialysis.
Cell Lines and Culture Conditions
Mouse macrophage J774A.1 cell line and ovarian cancer cell line SKOV3 cell line were obtained from ATCC and PPD, respectively. The cells were grown in monolayers in humidified air with 5% CO2 at 37° C. in 60 mm2 Petri dishes (Corning) containing 5 mL of DMEM supplemented with 10% FBS. For experiments, cells were harvested by scraping (J774A.1) or trypsinization (SKOV3), and were seeded into 24 or 96-well plates at a density of 5×105 cells.
Staphylococcal aureus (ATCC 29213) and Pseudomonas aeruginosa (ATCC 700289) were maintained weekly on Nutrient agar plates and slants. Fresh cultures were grown up to 24 hours prior to experiment.
Imaging
Phase contrast light microscopy and confocal microscopy (Olympus) was used to image liposomal suspensions, cochleates and cells, with and without the aid of fluorescence, which can be used, e.g., to study cellular uptake and intracellular distribution of fluorescently labeled cochleates and cargo moieties. Confocal microscopy is particularly advantageous as it is a 3-dimensional digital imaging device that can be used to effectively view slices of cell culture. This allows verification of the presence of cochleate and other agents within a cell.
Particle Size Analysis
Two different devices were used to examine particle size. The N4 plus (Coulter) measures particles in the range 10 nm to 3000 nm. The LS230 (Beckman/Coulter) measures particles in the range 40 nm to 1 mm. Using the two devices provides the flexibility and capability to evaluate formulations ranging from nanocochleates to large aggregates of cochleates.
Fraunhofer was used as the optical model for all the experiments. The optical models used to calculate absolute particle size were for spherical particles. Since cochleates are not spherical, the numbers given are relative, not absolute values, but nonetheless allow batch to batch sample comparisons. The results obtained by the two different devices give a qualitative comparison of the size differences between the formulations. However, light and electron microscopy have confirmed that the “nanocochleates” obtained are submicron in size.
Example 1
Amphotericin B Cochleate (CAMB) Prepared with DMSO and Lipid:AmB Ratios of 10:1, 2:1 and 1:1 w/w
Amphotericin B cochleates (CAMB) were prepared with Soy PS and DMSO with Vitamin E, and a Lipid to AmB ratio of 10:1 as follows.
Preparation of Liposomes
20 ml of water was added to 200 mg of Soy-PS in a 50 ml plastic tube, vortexed for about 15 minutes to form a liposomal suspension, and filtered using a 0.45 μm filter. The suspension was sonicated for about 4 minutes and filtered again with a 0.22 μm filter.
Addition of Cargo Moiety and Antioxidant in Solvent
1.90 ml of DMSO solvent was added to 20 mg of Amphotericin B in a 15 ml plastic tube. To the AmB/DMSO mixture, 0.1 ml of Vitamin E (20 mg/ml in DMSO), vortexed for about 10 minutes. This solution was then added to the liposomal suspension by drop wise addition using a 1 ml pipette while vortexing. The final mixture was vortexed for about 2 minutes.
Precipitation of Cochleates
2 ml of calcium (0.1 N) was added to the liposomal suspension at a rate of 10 μl/10 s while vortexing to form cochleates.
Solvent Removal/Washing
The mixture was vortexed for about 1-2 minutes, centrifuged for about 1 hours at 9000 rpm, and the supernatant was removed and replaced with fresh supernatant (water with 2 mM calcium). This washing step was repeated once.
Employing the above method, cochleates having a lipid to drug ratio 2:1 and 1:1 also were prepared by varying the ingredients to conform to following formulations.
TABLE 1
Cochleate Formulations
CAMB
CAMB
1:1
2:1
Soy PS (mg)
100
200
AmB (mg)
100
100
Vitamin E (mg)
1
2
DMSO (ml)
2
2
Water (ml)
10
20
Calcium (ml)
1
2
Washings with sterile water w/calcium (1 mM)
2
2
Final Volume (ml)
10
20
Summary of Results
For each cochleate formulation, a yellowish suspension with some of the cochleates floating on the top and/or residing on the bottom of the suspension were observed macroscopically.
FIG. 4 is a series of images of the formulation having a 1:1 ratio at different stages in the formulation: liposomes, liposomes with AmB, cochleates, and cochleates after addition of EDTA. FIGS. 5, 6 and 7 are each a series of images, before and after addition of EDTA, of the cochleate formulations having a 10:1, 2:1, and 1:1 ratio, respectively.
FIG. 8 is a graph of the size distribution of the liposomes after vortexing and prior to filtration, after filtration with 0.45 μm filter, and after introducing DMSO/Amphotericin. FIG. 9 is a graph of the size distribution of cochleate formulations having lipid to AmB ratios of 10:1, 2:1 and 1:1.
Example 2
Amphotericin B Cochleates Prepared with NMP
Cochleates were prepared as described in Example 1, except N-methylpyrrolidone (NMP) solvent was used instead of DMSO, and the formulation was adjusted as indicated in the following table.
TABLE 2
NMP 10:1 Formulation
CAMB/NMP
10:1
Soy PS (mg)
200
AmB (mg)
20
Vitamin E (mg)
2
DMSO (ml)
2
Water (ml)
20
Calcium (ml)
2
Washings with sterile water w/calcium (1 mM)
2
Final Volume
20 ml
Cochleates in the final formulations were observed as a yellowish suspension. Mice infected with a lethal dose of Aspergillus fumigatus were dosed with 2 mg/kg of the AmB-cochleate formulation for 14 days. The cochleates were efficacious against the A. fumigatus.
Example 3
Amphotericin B Cochleates Prepared with DMSO and Lipid:AmB Ratios of 5:1, 4:1, 3:1 and 2:1 w/w
Amphotericin B cochleates (CAMB) were prepared with soy PS and DMSO with tocopherol (Vitamin E) with the following protocol:
1. Weighing and placing 300 mg of soy PS into a 50 ml pp sterile tube with 10 ml sterile water.
2. Vortexing the suspension for 2 minutes.
3. Sonicating the suspension for 3 minutes.
4. Filtering the suspension with a 0.22 μm filter and pooling liposomes into a 50 ml tube.
5. Weighing and placing 10 mg (5:1), 12.5 mg (4:1) 16.6 mg (3:1) and 25 mg (2:1), of AmB (individually) into four 15 ml pp sterile tubes with 0.5 ml DMSO and vortexing.
6. Adding 6.0 μl (5:1), 6.2 μl (4:1), 6.6 μl (3:1), and 7.5 μl (2:1) of tocopherol at 10 mg/ml in DMSO to the 15 ml tubes with AmB. (The concentration of the AmB was 20 mg/ml 5:1), 25 mg/ml (4:1), 33.2 mg/ml (3:1), and 50 mg/ml (2:1), at this time)
7. Vortexing the solution for a few minutes until the AmB completely dissolved.
8. Adding 5 ml of liposomes to each AmB/Vitamin E/DMSO solution, and vortexing the sample for a few minutes.
9. Adding 0.5 ml of 0.1M calcium solution into the suspension with vortexing, using an eppendorf repeater pipette with a 500 μl tip and adding 10 μl aliquots to the tube per every 10 sec.
10. Centrifuging the suspension for 30 minutes at 9000 rpm at 4° C.
11. Removing the supernatant from the tube and re-suspending the pellet with the same volume of wash buffer (sterile water with 2 mM calcium).
12. Repeating steps 10 and 11 two more times. Adjusting the final volume of the suspension to 6 ml with wash buffer.
13. Examining the final preparation under a microscope and confirming the pH of 5.5.
14. Streaking the sample on a chocolate plate to check the sterilization of the final preparation and incubating plates at 37° C., 4° C., and room temperature for 24 hrs, 48 hrs, and 72 hrs.
15. Storing the sample, treated with nitrogen and covered with parafilm, at 4° C.
The following table summarizes the above formulations.
TABLE 3
CAMB Preparations
Name of
PS:AmB
AmB
0.1M
Final AmB
Sample
(w/w)
AmB
Soy PS
V-E
liposome
Calcium
(mg/ml)
CAMB 5:1
5:1
10 mg
50 mg
60 μg
5.5 ml
0.5 ml
1.66 mg/ml
CAMB 4:1
4:1
12.5 mg
50 mg
62.5 μg
5.5 ml
0.5 ml
2.08 mg/ml
CAMB 3:1
3:1
16.6 mg
50 mg
66.6 μg
5.5 ml
0.5 ml
2.76 mg/ml
CAMB 2:1
2:1
25 mg
50 mg
75 μg
5.5 ml
0.5 ml
4.16 mg/ml
About 0.5 ml DMSO was used in each preparation. HPLC and LC/MS were used to measure the AmB and DMSO concentrations.
Summary of Results
1. Macroscopic observations: yellowish suspension.
2. Microscopic observations: cochleates with different size of aggregates.
3. Addition of EDTA: liposomes formed after addition of EDTA (chelator).
4. Recovery: HPLC analysis indicated that approximately 100% of the AMB was successfully encochleated.
5. For the mouse study described in Example 4, the following amounts of each formulation were set aside:
5:1=>0.4 mg/ml×1.2 ml, 14 bottles
4:1=>0.4 mg/ml×1.2 ml, 14 bottles
3:1=>0.4 mg/ml×1.2 ml, 14 bottles
2:1=>0.4 mg/ml×1.2 ml 14 bottles
For the in vitro study described in Example 5, the following amounts of each formulation were set aside:
5:1=>0.34 mg/ml×100 ul (Conc: PS=1.7 mg/ml)
4:1=>0.42 mg/ml×100 ul (Conc: PS=1.7 mg/ml)
3:1=>0.56 mg/ml×100 ul (Conc: PS=1.7 mg/ml)
2:1=>0.85 mg/ml×100 ul (Conc: PS=1.7 mg/ml)
6. Sterility: No bacteria observed in the formulations after 72 hrs.
Example 4
Efficacy Studies in Mice
The formulations of Example 3 were administered to mice to study the efficacy of the formulations to protect mice from a lethal dose of Candida albicans, and to clear the organs of C. albicans in the surviving mice.
Six groups of 10 mice were studied. The mice were administered 5×105 cells C. albicans intravenously through the tail vein. Starting 24 hours post-infection, the following compositions were administered to each group orally once daily at 2 mg AmB/kg body weight for 14 days, except for the control group which remained untreated.
a. Control (untreated)
b. AmB/deoxycholate (FUNGIZONE)
c. CAMB 2:1 AmB
d. CAMB 3:1 AmB
e. CAMB 4:1 AmB
f. CAMB 5:1 AmB
Appearance and behavior was monitored each day of the study. Tissue burden of C. Albicans was determined in kidney, liver and lungs for each animal, and colony counts were taken. Organs were obtained and weighed, homogenized, dilutions in buffer made, and aliquots plated onto plates; colony counts of fungus were taken several days later. FIG. 10 is a graph of the survival data for C. albicans-infected mice untreated (control), or dosed daily for 14 days with AmB/deoxycholate, or AmB-cochleates with a lipid to drug ratio of 2:1, 3:1, 4:1, or 5:1.
FIG. 11 is a chart of the average number of C. albicans cells/gram of tissue in the liver, kidney, and lungs of C. albicans-infected mice untreated and dosed daily for 14 days with AmB/deoxycholate, or AmB-cochleates with a lipid to drug ratio of 2:1, 3:1, 4:1, or 5:1.
One hundred percent of the control (untreated) group did not survive the study and showed high tissue burdens. All four AmB-cochleate (CAMB) formulations were effective in preventing mortality and reducing fungal cell burdens in target organs (kidneys, lungs and liver). The CAMB 5:1 and CAMB 3:1 formulation appeared somewhat better than the others clearing the liver and lungs completely (the principal target organ for C. albicans (kidney) was not completely cleared). The CAMB 5:1 formulation appeared to be the most effective versus the others in reducing fungal cell burdens in the kidneys. In general, the CAMB formulations were more effective than the AmB/deoxycholate formulation.
Example 5
Efficacy Studies in Cells
The relative efficacy of the compositions of Example 3 were studied in J774A.1 macrophages to compare the relative efficacy of the cochleate compositions (5:1, 4:1, 3:1 and 2:1) against Candida albicans.
Macrophages were seeded into a 96-well plate and incubated overnight as described above. Following incubation, the macrophages were infected with C. albicans at a ratio of 1:200 with respect to the macrophages. The AmB-cochleates were then added at the concentrations of 0.1, 0.01 and 0.001 μg. Twenty-four hours later, the cell cultures were lysed, samples were plated onto agar plates, and colonies were counted the following day.
FIG. 12 is a graph of the number of colony forming units (CFU) for the C. albicans-infected macrophages dosed with varying concentrations of AmB-cochleates with lipid to drug ratios of 2:1, 3:1, 4:1, and 5:1. All cochleate formulations were efficacious at killing C. albicans;
Example 6
Amphotericin B Cochleates Prepared with DMSO and Lipid:AmB Ratios of 5:1, 2:1, and 1:1 w/w
Multiple batches of Amphotericin B cochleates (CAMB) were prepared with DMSO and tocopherol (Vitamin E) by the following steps. Two methods for the removal of solvent were employed: removal of solvent by washing the cochleates and removal of solvent by dialysis of the liposomal suspension.
1. Weighing and placing 100 mg of soy PS into a 50 ml pp sterile tube with 10 ml sterile water.
2. Vortexing the suspension for 2 minutes.
3. Sonicating the suspension for 3 minutes.
4. Filtering the suspension with a 0.22 um filter and pooling the liposomes into a 50 ml tube.
5. Weighing and placing 10 mg (5:1), 25 mg (2:1), and 50 mg (1:1) of AmB into 4, 15 ml pp sterile tubes with 0.5 ml DMSO (1 ml DMSO for 1:1).
6. Adding 7.5 μl (2:1), 6.0 μl (5:1), and 10 μl (1:1) of tocopherol at 10 mg/ml to the DMSO (the concentration of the AmB will be 20 mg/ml (5:1), 50 mg/ml (2:1), and 50 mg/ml (1:1) at this time),
7. Vortexing the solution for a few minutes until the AmB dissolved completely.
Remainder of Method when Removing Solvent by Washing Cochleates
1. Mixing 5 ml of liposome with 0.507 ml of the AmB/DMSO suspension, and vortexing the sample for a few minutes.
2. Adding 0.5 ml of 0.1M calcium solution into the suspension with vortexing, using an eppendorf repeater pipette with a 500 ul tip and adding 10 μl aliquots to the tube per every 10 sec.
3. Centrifuging the suspension for 30 minutes at 9000 rpm at 4° C.
4. Removing the supernatant from the tube and re-suspending the pellet with wash buffer of same volume (2 mM calcium with sterile water).
5. Repeating steps 3 and 4. Adjusting the final volume of the suspension to 5 ml with 2 mM calcium wash buffer.
Remainder of Method when Removing Solvent by Dialysis of Liposomes
1. Transferring 6 ml (1:1), and 5.5 ml (2:1 and 5:1), of AmB/DMSO/liposomes into dialysis tubes individually.
2. Starting the removal the DMSO using dialysis by changing the sterile water several times and leaving overnight.
3. On the next day, transferring the AmB/liposomes into the 50 ml sterile tubes, and saving 0.5 ml of AmB/liposomes for the HPLC analysis.
4. Precipitating the liposomes by adding 0.5 ml of 0.1M calcium to each 50 ml tube of AmB/liposomes. About 6.0 ml were precipitated for the 5:1 and 2:1 samples, and 6.5 ml were precipitated for the 1: sample 500 μl of liposomes were saved for the HPLC assay from each sample. The pH was about 4.0 at this point after dialysis, and was readjusted to a pH of 5.5 to 6.0 with 1N NaOH in final preparation.
Sterilization/Stability/Storage of Preparations
1. Stability: The final preparations from both methods were examined under a microscope, and the pH (about 5.5) was confirmed.
2. Sterility: Samples of each preparation were streaked on a chocolate plate to check the sterilization of the final preparation, and incubated at 37° C., 4° C., and room temperature for 24 hrs, 48 hrs, and 72 hrs.
3. Storage: The samples, treated with nitrogen and covered with parafilm, were stored a 4° C.
The above formulations can be summarized as follows.
TABLE 4
CAMB Formulations
Name of
Ratio of
Amount
Amount of
AmB
0.1M
Final Conc. Of
Sample
PS:AmB(w/w)
of AmB
soy PS
Tocopherol
liposome
Calcium
AmB (mg/ml)
AmB/DMSO
2:1
25 mg
50 mg
75 μg
5.5 ml
0.5 ml
≈5 mg/ml
(washing)
AmB/DMSO
5:1
10 mg
50 mg
60 μg
5.5 ml
0.5 ml
1.52 mg/ml
(dialysis)
AmB/DMSO
2:1
25 mg
50 mg
75 μg
5.5 ml
0.5 ml
≈3.8 mg/ml
(dialysis)
AmB/DMSO
1:1
50 mg
50 mg
100 μg
6.0 ml
0.5 ml
≈7.1 mg/ml
(dialysis)
The recovery of AmB was determined using HPLC assay.
Results
1. Macroscopic observations: yellowish suspension with some settles on the bottom of the tubes.
2. Microscopic observations: aggregated and individual cochleates were observed.
3. Addition of EDTA: liposomes formed upon addition of EDTA
4. Images of cochleate: FIG. 13 is a series of images of the 5:1 AmB cochleates (top two panels) and the cochleates after addition of EDTA (bottom two panels).
6. Recovery: HPLC analysis indicated that following amounts of AmB encochleated for each formulation indicated.
2:1 (Washing)=>81%
5:1 (Dialysis)=>91%
2:1 (Dialysis)=>92%
1:1 (Dialysis)=>92%
7. Outcome: For the mouse study described in Example 7, the following amounts of each formulation were set aside:
2:1 (Washing)=>0.2 mg/ml×2.5 ml, 14 bottles
5:1 (Dialysis)=>0.2 mg/ml×2.2 ml, 14 bottles (using 2nd batch)
2:1 (Dialysis)=>0.2 mg/ml×2.5, 14 bottles
1:1 (Dialysis)=>0.2 mg/ml×2.5 ml 14 bottles
Example 7
Efficacy Studies in Mice
The formulations of Example 6 were administered to mice to study the efficacy of the formulations to protect mice from a lethal dose of Candida albicans, and to clear the organs of C. albicans in the surviving mice.
Six groups of 10 mice were studied. The mice were administered 106 cells C. albicans intravenously through the tail vein. Starting 24 hours post-infection, the following compositions were administered to each mouse once daily at 2 mg/kg orally for 14 days, except for the control group, which remained untreated.
a. Control Group (untreated)
b. AmB/deoxycholate
c. CAMB 2:1 (Washed)
d. CAMB 5:1 (Dialysis)
e. CAMB 2:1 (Dialysis)
f. CAMB 1:1 (Dialysis)
Appearance and behavior was monitored each day of the study. Tissue burdens of C. albicans were determined in kidney, liver and lungs for each animal at the end of the study, and colony counts were taken. Organs were obtained and weighed, homogenized, dilutions in buffer made, and aliquots plated onto plates and colony counts of fungus taken several days later.
Summary of Results
FIG. 14 is a graph of the survival data for the C. albicans-infected mice untreated or dosed daily for 14 days with AmB/deoxycholate (AmB/D), or AmB cochleates with a lipid to drug ratio of 5:1 (dialysis), 2:1 (dialysis), 1:1 (dialysis), or 2:1 (wash).
FIG. 15 is a chart of the average number of C. albicans cells/gram of tissue in the liver, kidney, and lungs of C. albicans-infected mice untreated (control), or dosed daily for 14 days with AmB/deoxycholate (AmB/D), or AmB-cochleates with lipid to drug ratios of 5:1 (dialysis), 2:1 (dialysis), 1:1 (dialysis), or 2:1 (washing).
Seventy percent of control (untreated) animals died and showed high tissue burdens, while all four cochleate formulations were effective in preventing mortality and reducing fungal cell burdens in target organs (kidneys, lungs and liver). The 5:1 (dialysis) formulation appeared more effective than the others in clearing the liver completely. The 2:1 (washed) and 2:1 (dialysis) formulations had nearly the same efficacy. All formulations (excepted for 1:1 (dialysis) formulation) reduced the fungal cell burden as well as or better than the AmB/deoxycholate formulation. Overall, the data are consistent with effective oral delivery of AmB from cochleates.
Example 8
Efficacy of Cochleates in Cells
The relative efficacy of the compositions of Example 6 were studied in J774A.1 macrophages to compare the relative efficacy of the cochleate compositions against Candida albicans.
Macrophages were seeded into a 96-well plate and incubated overnight as described above. Following incubation, the macrophages were infected with C. Albicans at a ratio of 1:200 with respect to the macrophages. The AmB-cochleate formulations were then added at the concentrations of 0.1, 0.01 and 0.001 μg/ml. Twenty-four hours later, the cell cultures were lysed, samples plated onto agar plates, and counted the following day.
FIG. 16 is a graph depicting the number of colony forming units (CFUs) for C. albicans-infected macrophages dosed with varying concentrations (0.1, 0.01 and 0.001 μg/ml) of AmB-cochleate formulations having lipid to drug ratios of 5:1 (dialysis), 2:1 (dialysis), 1:1 (dialysis), and 2:1 (washing), or AmB/deoxycholate (AmB/D). The 2:1 (washing) and the 5:1 (dialysis) formulation were the most efficacious at killing the C. albicans at 0.001 μl/ml. In contrast, the AmB/deoxycholate CFU's were too numerous to count at this concentration.
Example 9
Amphotericin B Cochleates Prepared with DMSO and Lipid:AmB Ratio of 5:1 with and without Methylcellulose
Amphotericin B cochleates were prepared using Soy PS and DMSO with Vitamin E, and a Lipid to AmB ratio of 5:1 as follows.
Preparation of Liposomes
20 ml of water was added to 200 mg of Soy-PS, vortexed for about 15 minutes to form a liposomal suspension, and filtered using a 0.45 μm filter. The suspension was sonicated for about 4 minutes and filtered again with a 0.22 μm filter.
Addition of Cargo Moiety and Antioxidant in Solvent
2 ml of DMSO solvent was added to 40 mg of Amphotericin B. To the AmB/DMSO mixture was added 2 mg of Vitamin E and the solution was vortexed for about 10 minutes. This solution was then added to the liposomal suspension by drop wise to addition while vortexing. The final mixture was vortexed for about 2 minutes.
Precipitation of Cochleates
2 ml of calcium (0.1 M) was added to the liposomal suspension at a rate of 10 μl/10 s while vortexing to form cochleates.
Solvent Removal/Washing
The mixture was vortexed for about 1-2 minutes, centrifuged for about 1 hour at 9000 rpm, and the supernatant was removed and replaced with fresh supernatant (water with 2 mM calcium). This washing step was repeated twice.
Inhibition of Aggregation
0.1%, 0.2%, 0.3%, 0.4%, or 0.5% (w/w) methylcellulose (MC) to inhibit aggregation and 0.2% (w/w) parabens to maintain sterility were added to the suspension, and it was lyophilized to form a powder.
Images of cochleates containing 0.2%, 0.3% and 0.5% methylcellulose are given in FIG. 58. Particle size distributions in FIG. 59 show that the addition of methylcellulose decreases aggregation, and that the addition of paraben slightly increases aggregation. FIG. 60 is an HPLC analysis of the cochleate showing that amphotericin B is the only compound within the cochleate structure.
Example 10
Efficacy Studies in Mice
AmB/deoxycholate and 5:1 AmB cochleates (CAMB) formulated as described in Example 9 with and without 0.3% methylcellulose (MC) were administered to mice to study the efficacy of the formulations to protect mice from a lethal dose of Candida albicans, and to clear the organs of C. albicans in the surviving mice.
Six groups of 10 mice were studied. The mice were administered 5×105 cells C. albicans intravenously through the tail vein. Starting 24 hours post-infection, the following compositions were administered to each group once daily for 14 days in the dosage indicated, except for the control group which remained untreated.
a. Control
b. AmB/deoxycholate 2 mg/kg ip
c. 5:1 CAMB (suspension) with 0.3% MC, 1 mg/kg AmB oral dosing
d. 5:1 Lyophilized CAMB with 0.3% MC, 1 mg/kg AmB oral dosing
e. 5:1 CAMB (suspension), 1 mg/kg AmB oral dosing
f. 5:1 Lyophilized CAMB, 1 mg/kg AmB oral dosing
Appearance and behavior was monitored each day of the study. On day 15, mice were sacrificed and tissue burden of C. Albicans was determined in kidney, liver and lungs for each animal. Organs were obtained and weighed, homogenized, diluted in buffer, and aliquots were plated onto plates; colony counts of fungus were taken several days later.
FIG. 17 is a graph of the survival data for the C. albicans-infected mice untreated or dosed daily for 14 days with AmB/deoxycholate (AmB/D), or AmB cochleates (CAMB) in suspension or lyophilized and formulated with or without methylcellulose (MC).
FIG. 18 is a chart of the average number of C. albicans cells/gram of tissue in the liver, kidney, and lungs of C. albicans-infected mice untreated (control), or dosed daily for 14 days with AmB/deoxycholate, or AmB-cochleates (CAMB) in suspension or lyophilized and formulated with or without methylcellulose (MC).
One hundred percent of control (untreated) animals died by day 10 and showed high tissue burdens. AmB/deoxycholate at 2 mg/kg resulted in 100% survival and completely cleared Candida from the liver and lungs and decreased the tissue burden in the kidney by 2-3 log units. Forty percent of the mice treated with CAMB without methylcellulose (both in suspension and lyophilized) died and both groups also showed substantial tissue burdens in target organs. However, CAMB with methylcellulose in suspension and lyophilized CAMB with methylcellulose afforded 100% and 80% survival, respectively, and showed several log order reductions in tissue burden relative to the other CAMB formulation. The antifungal properties of CAMB with methylcellulose in suspension at 1 mg/kg administered PO mimicked the behavior of AmB/deoxycholate at 2 mg/kg administered IP. Overall, cochleates with methylcellulose showed stronger antifungal properties than cochleates without methylcellulose.
Example 11
Efficacy Studies in Cells
The relative efficacy of the compositions of Example 9 were studied in J774A.1 macrophages to compare the relative efficacy of the cochleate compositions (with and without methylcellulose) against Candida albicans.
Macrophages were seeded into a 96-well plate and incubated overnight as described above. Following incubation, the macrophages were infected with C. albicans at a ratio of 1:200 with respect to the macrophages. The AmB-cochleates were then added at the concentrations of 5, 1, 0.1, 0.01 and 0.001 μg/ml. Twenty-four hours later the cell cultures were lysed, samples were plated onto agar plates, and colonies were counted the following day.
FIG. 61 is a graph of the number of colony forming units (CFU) for the C. albicans-infected macrophages dosed with AmB-cochleates in suspension and lyophilized with lipid to drug ratio 5:1, with and without methylcellulose. All cochleate formulations were efficacious at killing C. albicans.
Example 12
Scale Up
Amphotericin B cochleate preparation was scaled up to 5 liters using Soy PS and DMSO with Vitamin E, and a Lipid to AmB ratio of 5:1 as follows.
Preparation of Liposomes
5.4 L of water was added to 50 g of Soy-PS, vortexed for about 15 minutes to form a liposomal suspension, and filtered using a 10 μm filter.
Addition of Cargo Moiety and Antioxidant in Solvent
500 ml of DMSO solvent was added to 10 g of Amphotericin B. To the AmB/DMSO mixture was added 60 mg of Vitamin E and the solution was vortexed for about 10 minutes. This solution was then added to the liposomal suspension by drop wise addition using a separatory funnel while vortexing. The final mixture was vortexed for about 2 minutes.
Precipitation of Cochleates
100 ml of calcium (0.5 M) was added to the liposomal suspension at a rate of 10 μl/10 s while vortexing to form cochleates.
Solvent Removal/Washing
The mixture was vortexed for about 1-2 minutes, centrifuged for about 1 hour at 9000 rpm, and the supernatant was removed and replaced with fresh supernatant (water with 2 mM calcium). This washing step was repeated twice.
Optional Inhibition of Aggregation
0.3% (w/w) methylcellulose (MC) to inhibit aggregation and 0.2% (w/w) parabens to maintain sterility were added to the suspension, and it was lyophilized to form a powder. Subsequently, the cochleates were treated with rabbit serum albumin and forced multiple times through a high pressure homogenizer such as the Avestin EmulsiFex-C5. Homogenization pressure was maintained around 15K to 20K psi. Particle size distributions of cochleates before treatment with albumin, after two passes through a homogenizer and after seven passes through a homogenizer are shown in FIGS. 62, 63 and 64, respectively.
Example 13
Geldanamycin Cochleates
Geldanamycin (GA)-cochleates were prepared as described in Example 1. The cochleates were observed macroscopically to have successfully encochleated GA, and also included crystals, possibly including unencochleated GA. When cochleates were centrifuged, about one third of the GA was present in the supernatant. Overall, the GA was successfully encochleated.
Example 14
Tyrphostin Cochleates
Tyrphostin AG-825 (TY)-cochleates were prepared using the solvent drip method described in Example 1. Good morphology of TY-cochleates was observed, in that it appeared that TY was successfully encochleated.
HPLC Analysis and Stability of TY-Cochleate Formulation
HPLC was used to study the stability of the TY in the cochleates, by measuring the concentration of TY in TY-cochleates as compared to free, i.e., unencochleated TY in solution.
FIG. 19 is a graph of the concentration of TY-cochleate preparations versus free TY over time. As can the seen in FIG. 19, the free TY concentration decreased to zero over time. In contrast, the TY concentration initially dropped for the TY-cochleates (possibly due to the degradation of free TY in the cochleate formulation), and stabilized thereafter.
TY degrades into two products (identified as impurity 1 and impurity 2 in FIG. 20). FIG. 20 is two graphs of the concentration of each impurity over time for both the free TY and TY-cochleates studied in FIG. 19. FIG. 20 confirms that the free TY degraded over time, whereas, after an initial degradation was observed, the concentration of degradation products remained fairly stable for the TY-cochleates.
Biological Evaluation of Tyrphostin AG-825 Cochleates
Cytotoxicity of TY-cochleates was studied in a SKOV3 cell line (FIG. 21). The TY-cochleates showed slightly higher cytotoxicity against the cancer cell line than that from free TY. The data for empty (drug free) cochleates also is shown.
Results
Tyrphostin AG-825 was successfully formulated into cochleates using the method of the present invention. Stability tests demonstrated that TY-cochleates have a superior stability as compared to free TY in solution, and biological analysis of TY-cochleates indicated that it delivered similar cytotoxic effects on SKOV3 cell line to that of its free form in solution.
Porphyrin-cochleates also have been successfully made with ethanol, DMG and THF solvents.
Example 15
Porphyrin Cochleates
Porphyrin cochleates were prepared with Zinc Tetra-Phenyl Porphyrin (ZnTPP) and DMSO as described in Example 1, adjusted for a lipid to ZnTPP ratio of 20,000:1 w/w.
The particle size and fluorescence of: plain liposomes; liposomes with ZnTPP; and cochleates with ZnTPP, were evaluated and the following results were obtained.
TABLE 5
Particle Size and Fluorescence
Particle Size
Particle Size
Fluorescence
Intensity
Mean (nm)
StD (nm)
Max (nm)
(a.u.)
Liposomes
300.1
132.4
Liposomes +
280.1
122.9
595.5
45338
ZnTPP
Cochleates +
<10 μm
596
43589
ZnTpp
FIG. 22 is an image of ZnTPP in solution (100% DMSO), and the ZnTPP-cochleates. The ZnTPP in solution was dark purple, and the cochleate formulation was only slightly colored (pink), indicating that the ZnTPP was successfully incorporated into the cochleates, which are white.
FIG. 23 is a series of phase contrast images (left panels) and fluorescence images (right panels), of the ZnTPP-cochleates (top panels) and ZnTPP-liposomes (bottom panels) formed. These images indicate that the ZnTPP was successfully associated with the liposomes and successfully encochleated.
Comparison to Cochleates Formed without Solvent
FIG. 24 is a series of phase contrast images (left panels) and fluorescence images (right panels), of ZnTPP-cochleates (top panels) and ZnTPP-liposomes (bottom panels) formed without the presence of solvent. FIG. 24 indicates that the ZnTPP did not successfully associate with the liposomes or cochleates in the absence of solvent.
Interaction of ZnTPP-Cochleates with SKOV3 Cells
In order to study any interaction of the cochleates with cells, ZnTPP-cochleates and free ZnTPP (in solution with DMSO) were introduced to SKOV3 cell cultures, and imaged with fluorescence under a confocal microscope.
FIG. 25 is a series of images of the SKOV3 cell culture with the ZnTPP cochleates at 1 hour and 24 hours. The images demonstrate uptake of the ZnTPP-cochleates into the perinuclear region, and that the ZnTPP had not significantly degraded at 24 hours.
FIG. 26 is a series of images of the SKOV3 cell culture with the free ZnTPP (in DMSO) at 1 hour and 24 hours. The images indicate high uptake of the ZnTPP solution at one hour, but significant degradation at 24 hours. The appearance and distribution of ZnTPP is different than that observed with the ZnTPP cochleates of FIG. 25.
Study of ZnTPP-Cochleates Using a Lipid Imaging Agent
Cochleates were prepared with and without ZnTPP as described above, except that prior to introduction of the ZnTPP/solvent, liposomes were formed with 1% diolyl phosphatidylethanolamine (DOPE) liganded to pyrene (purchased Avanti). The DOPE was incorporated into the soy PS liposomes by dissolving both DOPE and lipid in solvent, drying the solvent to a film, and using an aqueous solution to form liposomes. Confocal images were taken at 1 and 24 hours after introduction to SKOV3 cells to study the uptake and any difference in the cellular distribution of cochleate/lipid and the ZnTPP. The study of distribution was possible because DOPE-pyrene fluoresces blue, and ZnTPP fluoresces red. ZnTPP in the cochleates/liposomes appears pink.
FIG. 27 is a series of images of the SKOV3 cell culture with the empty cochleates (including DOPE-pyrene lipid) at 1 hour and 24 hours. These images indicate uptake of the empty cochleates by the cells.
FIG. 28 is a series of images of the SKOV3 cell culture with the ZnTPP-cochleates (including DOPE-pyrene lipid) at 1 hour and 24 hours. These images indicate uptake of the cochleates by the cells at both 1 and 24 hours. The images also indicate a redistribution of lipid and ZnTPP in the cells at 24 hours versus 1 hour. It appears that a portion of the ZnTPP has separated from the cochleates at 24 hours.
Together, FIGS. 27 and 28 indicate high uptake of cochleates by the cell, and subsequent release of porphyrins from the cochleates in the cell. The Figures also indicate that, once inside the cell, the porphyrin is more stable in the cochleate than free.
Example 16
Preparation of NSAID Cochleates
Acetaminophen Cochleate Preparation
Acetaminophen and DOPS were mixed in a sterile, polypropylene tube with a rubber policeman. TES buffer was added to the tube to disperse the mixture in a ratio of 10 mg lipid/ml. The cochleates were formed by the slow addition (10 μL) of calcium chloride (0.1M) to the suspension of liposomes at a molar ratio of lipid to calcium of 2:1 with an external excess of 6 mM calcium and then stored at 4° C. in the absence of light.
Acetaminophen cochleates were formulated with and without aggregation inhibitor, casein, which was added to the buffer solution prior to the addition of calcium chloride in a casein to lipid ratio of 1:1 by weight.
Images were taken of the cochleates formed with (FIG. 37A, left panel) and without (FIG. 37A, right panel) the aggregation inhibitor. As demonstrated by the images, cochleates formed in the presence of casein did not aggregate as did the cochleates formed without the aggregation inhibitor.
Aspirin Cochleate Preparation
Aspirin and DOPS were solublized in chloroform in a lipid/aspirin molar ratio of 10:1 in a sterile glass tube. The sample was blown down with nitrogen to form a film. The sample was then resuspended in TES buffer, pH 7.4, at a ratio of 10 mg lipid/ml. The cochleates were formed by the slow addition (10 μL) of calcium chloride (0.1M) to the suspension of liposomes at a molar ratio of lipid to calcium of 2:1 with an external excess of 6 mM calcium and then stored at 4° C. in the absence of light.
Aspirin cochleates were formulated with and without an aggregation inhibitor, casein, which was added to the buffer solution prior to the addition of calcium chloride in a casein to lipid ratio of 1:1 by weight.
Images were taken of the cochleates formed with (FIG. 37B, left panel) and without (FIG. 37B, right panel) the aggregation inhibitor. As demonstrated by the images, cochleates formed with the aggregation inhibitor did not aggregate as did the cochleates without the aggregation inhibitor, which formed needle-like structures.
SUMMARY
The introduction of an aggregation inhibitor to the cochleates loaded with a variety of cargo moieties inhibited cochleate aggregation. All cochleate formulations with casein were significantly smaller than cochleates made without casein, and these cochleates were stable for at least two months with no noticeable aggregation. Cochleates formed without casein aggregated over time.
Addition of Methylcellulose
Aspirin or acetaminophen cochleates with and without casein were prepared as described above, except that liposomes were filtered through a 0.45 μm filter followed by a 0.22 μm filter, which resulted in unilamellar liposomes which contained the drug. Calcium chloride was added to the liposomes as also described above. Methylcellulose in suspension (0.5% of entire formulation) was added and the sample was vortexed.
The addition of methylcellulose at this particular concentration did not reverse aggregation, but rather inhibited further aggregation of cochleates. The size of cochleates subsequent to addition of methylcellulose was observed to remain stable.
Example 17
Inhibition of Edema in Rat Paw
A carrageenan model was employed to study the effect of anti-inflammatory cochleates on edema in rat paws. Various aspirin cochleates of the invention were used to treat carrageenan-induced rat paw edema. These results were compared to free aspirin and indomethacin and empty cochleates to determine the efficacy of encochleated anti-inflammatory drugs. Additionally, rats in all groups were examined for gastric irritation.
Samples Tested
1. Control (no treatment)
2. Indomethacin, 6 mg/kg
3. Aspirin control, 150 mg/kg
4. Large, empty cochleates
5. Small, casein cochleates
6. Large aspirin cochleates, 45 mg/kg
7. Large aspirin cochleates, 150 mg/kg
8. Small, casein aspirin cochleates, 45 mg/kg
9. Small, casein aspirin cochleates, 140 mg/kg
10. Large casein aspirin cochleates with 0.1% Vit E, 45 mg/kg
11. Large casein cochleates with 0.1% Vit E
Samples 6-10 were prepared in accordance with Example 16, except that the lipid:aspirin molar ratio was 5:1 and soy PS was used instead of DOPS. Samples 4, 5, and 11 were prepared in a similar manner in the absence of a cargo moiety. In all cases, water was used in lieu of TES buffer. All samples were given by oral gavage at 1 hour prior to injection of carrageenan on Day 0 in a volume of 3 mL of 0.5% methylcellulose. Methylcellulose at this concentration served to stabilize the cochleates but did not significantly affect the size or distribution of the standard or casein cochleates. Volumes of rat paw (in ml) were measured prior to carrageenan injection using a semi-automated plethysmograph (Buxco). At 0 time, 0.1 ml of 1% carrageenan in 0.9% pyrogen free saline was injected into the right hind paw of the rat. The paw volumes (in ml) were measured again 3 hours post carrageenan injection to determine inhibition of paw edema. Four rats from each of groups 2, 3, 6, 7, 8, 9 and 10 and one rat from each of groups 1, 4, 5 and 11 were bled (intravenously, jugular vein, approximately 1 ml blood) at 30 minutes and 4 hours post drug administration. Blood was collected in heparinized vacutainers. 4 hours post carrageenan injection, the stomachs of rats from all test groups were removed after euthanasia by CO2 asphyxiation to observe for gastric irritation (i.e. bleeding and ulcerations).
Inhibition of rat paw edema for all-samples is presented in FIG. 38. In general, the control group and the groups given cochleates not containing aspirin show no decrease in the level of edema in the rat paw. Large aspirin cochleates (cochleates not made with an aggregation inhibitor) show a decrease in edema only slightly larger than that of free aspirin or indomethacin. Small cochleates (with an aggregation inhibitor), however, show a significant decrease in edema in comparison to both free aspirin and indomethacin and large aspirin cochleates. Additionally, large aspirin cochleates with vitamin E show more of a decrease in edema when compared to plain large aspirin cochleates.
FIG. 39 shows the incidence and level of severity of gastric irritation produced by samples 2, 3, 7 and 9. In general, indomethacin produced the greatest gastric irritation, followed by unencochleated aspirin. Aspirin cochleate formulations produced less incidence of irritation when compared to both aspirin and indomethacin.
Example 18
Activation of Macrophages by Anti-Inflammatory Cochleates
To examine the effects of cochleates on lipopolysaccharide (LPS) plus IFN-γ induced NO production, J774A.1 macrophages were treated with LPS plus IFN-γ in the presence and absence of empty cochleates. Macrophages were also treated with and without empty cochleates in the absence of LPS plus IFN-γ.
Since NO production requires the enzymatic activity of NOS, its activity was measured by NO secretion using the method of Griess (nitrite). Briefly, 100 μl of sample was reacted with the Griess reagent at room temperature for 10 minutes. Amount of NO2 was then determined by measuring the absorbance at 540 nm in a microplate reader. The standard curve was obtained using the known concentration of sodium nitrite. In all experiments, NO2 concentration in wells containing medium only was also measured as a blank control.
FIG. 40 indicates that empty cochleates (EC) are immunologically inert. That is, they neither enhance nor inhibit NO production induced by LPS plus IFN-γ at all concentrations assayed. In contrast, the addition of LPS plus IFN-γ to the macrophages with and without empty cochleates resulted in a dramatic increase in iNOS production. In addition, all concentrations of the empty cochleates showed no sign of cellular toxicity as was observed under phase contrast microscopy.
In order to determine the in vitro efficacy of anti-inflammatory cochleates of the invention, J774A.1 mouse macrophages were incubated with LPS (1 μg/ml) plus IFN-γ (10 μg/ml) in the presence or absence of standard aspirin cochleates and acetaminophen cochleates prepared as described in Example 16, free aspirin, free acetaminophen and empty cochleates (control) for 15 hrs.
As shown in FIG. 41, standard cochleates containing aspirin and acetaminophen exhibited greater in vitro efficacy than free aspirin and acetaminophen at inhibiting NO production.
Example 19
Particle Size Analysis of Cochleates of the Invention
Cochleates stabilized with 1% casein were evaluated with the N4 plus from Coulter. Briefly, 20 μl of the suspension of empty cochleates prepared in accordance with Example 17 (without NSAIDs) were added to 2.5 ml of D.D. H2O. The samples were equilibrated over 20 minutes. The samples were then analyzed for 2 minutes at a 90° angle. Two different populations of cochleates were observed, one centered at 25 nm, and the other one at 350 nm (FIG. 34A). The population centered at about 25 nm likely consists of casein micelles and not cochleates. Any such micelles can be removed, e.g., by centrifugation.
The particle size of aggregated, standard cochleates was also evaluated using the LS230 from Coulter. 100 μl to 200 μl of the sample was added to 250 ml of washing buffer in the vessel until the PIDS (Polarization Intensity Differential Scattering) reached 45%. The duration time for a run was 120 s and the number of cycles was 3. Four different populations, one centered at approximately 1 μm, one at approximately 10 μm, one at approximately 30 μm and the last one at approximately 50 μm were observed. (FIG. 34B)
Example 20
Preparation of Cochleates with Various Aggregation Inhibitors
Rhodamine labeled phosphatidyl ethanolamine (Rho-PE) liposomes were prepared by adding di-oleoyl-PS (DOPS) and Rho-PS to chloroform at a ratio of 10 mg lipid/ml solvent. The DOPS was present at 0.1% or 0.01% of the total lipid. The sample was blown down under nitrogen to form a film. Once dry, the sample was resuspended in a TES buffer at a ratio of 10 mg lipid/ml buffer. The liposomes were then passed through a 0.22 μL filter. The homogeneous population of Rhodamine labeled liposomes were stored at 4° C. in the absence of light under nitrogen.
Sterile glass tubes, each containing 100 μl fluorescent Rhodamine cochleates in TES buffer were prepared Cochleates were formed by the addition of 10 μl aliquots of 0.1M calcium chloride until a molar ratio of lipid to calcium of 2:1 and an external excess of 6 mM calcium was reached. 10 μl Half and Half was added to one tube and vortexed for 4 minutes. Whole milk, at a 1:1 ratio of whole milk to lipid, was added to a second tube and vortexed for one minute. Evaporated fat free milk, at a 1:2 weight ratio of evaporated milk to lipid was added to a third tube and vortexed for 4 minutes. A fourth tube was used as the control, and as such, no aggregation inhibitor was added.
FIGS. 35A-D are four fluorescent images of the Rhodamine-labeled cochleates obtained. The Figures demonstrate the effect of formulating cochleates, in the presence of various aggregation inhibitors: half and half (FIG. 35A), whole milk (FIG. 35B), and fat-free milk (FIG. 35C). FIG. 35D is an image of the control composition of cochleates that do not include an aggregation inhibitor.
FIG. 36 depicts the aggregated cochleates prior to the addition of milk (left image) and after the addition of milk (right image). These images indicate that milk caused aggregation to reverse.
Example 21
Uptake of Cochleates by Macrophages
Rhodamine labeled phosphatidyl ethanolamine (Rho-PE) cochleates were prepared as described in Example 20, except that casein was added to the formulation prior to the addition of calcium in a casein to lipid ratio of 1:1. Additionally, no milk products were added to the casein-coated Rho-PE cochleates.
Sterile cover slips were placed in the wells of 24-well plates. J774.1 macrophages were harvested as described above, counted using a hemacytometer and seeded at a concentration of 1×105, and allowed to incubate overnight to ensure adherence. Rhodamine-PE cochleates were then added at a final concentration of 50 μg lipid/ml and 5 μg lipid/ml.
The cover slips were removed at the desired time point, generally about one hour, rinsed in DMEM to remove any free cochleates, placed inverted on microscope slides and observed for uptake using phase contrast and fluorescence microscopy. Standard cochleate formulations were observed to remain within the macrophage for several days and slowly transfer the fluorescent lipid from endocytic vessels throughout the rest of the macrophage. In contrast, the nanocochleates were only observed up to 36-hours after administration. Due to their size and/or altered surface characteristics, the cochleates with casein were taken up more aggressively than standard cochleates (without casein) by cultured cells. Nearly every cell incubated with the cochleate composition prepared with casein showed intracellular fluorescence, indicating that the cochleates were rapidly taken up by the macrophages (FIG. 33B). In contrast, standard cochleates were not taken up as aggressively by the macrophages as is shown by intracellular fluorescence (FIG. 33A).
Example 22
Cochleates Formed with Protonized Vancomycin
Cochleates Formed with and without Calcium
Vancomycin cochleates are expected to increase the oral bioavailability of vancomycin while limiting its side effects. Vancomycin cochleates were formed with and without calcium.
14.6 mg of Dioleoyl Phosphatidylserine (DOPS, Avanti, Ala.) was used as the starting lipid material for each cochleate formulation. The phospholipid powder and 7.6 mg protonized Vancomycin (Vanco) powder were mixed in a molar ratio of 4.3:1.1 mL of modified TES buffer (2 mM TES, 150 mM NaCl, 2 mM L-Histidine), adjusted at pH 3 was added to each mixture. To one formulation, calcium also was added. The mixture was vortexed for 2 minutes.
Optical microscopy, using phase contrast technique, revealed the presence of cochleates in both the formulation without calcium (FIG. 42), and the formulation with calcium (FIG. 43). The cochleates were centrifuged at 3000 rpm at 4° C. for 20 min. The content of Vanco in the aggregates was assessed by OD absorption at 282 nm with a spectrophotometer. Results showed that the lipid associated with the Vanco such that the vancomycin comprised about 40% of the precipitate by weight for the formulation without calcium and about 70% of the precipitate for the formulation with calcium.
Addition of EDTA chelating agent to the formulation with calcium resulted in a rapid transformation of the cochleate into opened structure (FIG. 44), suggesting that the cochleates included stacked sheets of lipid bilayer and cationic drug.
Cochleates Formed with Alternative Acidification Step
Vanco crystals were added to preformed DOPS liposomes (FIG. 45A). The vanco was solubilized as TES buffer (pH 7.4) was added to disperse the mixture in a ratio of 10 mg lipid/ml. HCl (0.1N) was used to bring the pH to 5.0 or 6.5, at which point an association of the Vanco with the lipid were visible under the microscope. The protonized Vanco was observed to associate with the negatively charged bilayer surface. 10 μL of calcium chloride (0.1M) then was slowly added to the suspension of liposomes at a molar ratio of lipid to calcium of 2:1 with an external excess of 6 mM calcium and then stored at 4° C. in the absence of light.
Cochleates Formed with and without an Aggregation Inhibitor
Vancomycin cochleates were formulated with an acidification step as described above with and without an aggregation inhibitor (casein), which was added to the buffer solution prior to the addition of calcium chloride in a casein to lipid ratio of 1:1 by weight.
Images were taken of the cochleates formed with (FIG. 45B) and without (FIG. 45C) casein. When EDTA was added to the cochleates, they were opened to form liposomes as shown in FIG. 45D. The efficacy of the cochleates against Staph. aureus was studied in vitro as described in Example 24, below.
Example 23
Cochleates Formed with Tobramycin
Cochleates Formed with Acidification Step
Tobramycin crystals were added to pre-formed liposomes (FIG. 48A). Tobramycin was solubilized as TES buffer (pH 7.4) was added to disperse the mixture in a ratio of 10 mg lipid/ml. HCl (0.1N) was used to bring the pH to 5.5, at which point an association of the tobramycin with the lipid were visible under the microscope. The protonized tobramycin was observed to associate with the negatively charged bilayer surface. 10 μL of calcium chloride (0.1M) was slowly added to the suspension at a molar ratio of lipid to calcium of 2:1 with an external excess of 6 mM calcium and then stored at 4° C. in the absence of light.
Cochleates Formed with and without an Aggregation Inhibitor
Tobramycin cochleates were formulated with and without an aggregation inhibitor (casein), which was added to the buffer solution prior to the addition of calcium chloride in a casein to lipid ratio of 1:1 by weight.
Images were taken of the cochleates formed with (FIG. 48B) and without (FIG. 48C) casein. EDTA was added to the cochleates of FIG. 48C and the cochleates were observed to open as shown in FIG. 48D. The efficacy of the cochleates against Staph. aureus was studied in vitro as described in Example 24, below.
Example 24
Bactericidal Activity of Cochleates
J774A.1 is a well characterized murine macrophage-like cell line that has been extensively used to study Staphylococcal aureus-macrophage interactions. The J774A.1 cells were maintained at −80° C. prior to use and were prepared for the phagocytosis assays as described above.
J774A.1 macrophages were counted using a hemacytometer, seeded into 96-well plates and incubated overnight. Following incubation, the macrophages were infected with Staphylococcal aureus or Pseudomonas aeruginosa at a ratio of 1:200 with respect to the macrophages.
Free Vanco and Vanco cochleates prepared with and without casein as described in Example 22, were added to the macrophages infected with Staph. A. at concentrations of 1, 5, 10, and 25 μg/ml.
Free tobramycin and tobramycin cochleates prepared as described in Example 23 with and without casein were added to the macrophages infected with P. aeruginosa and P. aeruginosa alone at concentrations of 1, 5, 10, and 25 μg/ml.
Following incubation for 3 and 6 hours, the plates were removed and observed. Medium was removed and replaced with 100 μl cold sterile water. The plates were incubated 10 minutes, at which point the 100 μl cold sterile water was pipetted vigorously to disrupt the cellular membrane. 25 μl of this suspension was placed onto Sabouraud Dextrose Agar plates, and placed in a dry incubator overnight at 37° C. Staphylococcal aureus or Pseudomonas aeruginosa colony forming units (CFU's) were counted the to following day.
FIGS. 46 and 47 are graphs demonstrating the efficacy data for the Vanco cochleates (with and without casein) against Staphylococcal aureus versus free vancomycin at 3 and 6 hours after administration, respectively.
FIGS. 49 and 50 are graphs demonstrating the efficacy of the tobramycin cochleates of the invention (with and without casein) against Pseudomonas aeruginosa, versus free tobramycin at 3 and 6 hours after administration, respectively.
As FIGS. 46, 47, 49 and 50 indicate, the cochleates of the invention increase the effectiveness of the cargo molecule against bacteria in cells. Additionally, vancomycin and tobramycin cochleates including an aggregation inhibitor show a significant increase in efficacy in relation to both free drug and cochleates formed without aggregation inhibitor.
Example 25
Caspofungin Cochleates
Cochleates Formed with Calcium—Solvent Drip Method
Soy phosphatidylserine (Soy PS, Degussa) was used as the starting lipid material for each cochleate formulation. 100 mg soy PS was mixed with 10 mL water or saline, and the mixture was vortexed, forming liposomes. 10 mg of protonized caspofungin (5 mg for 20:1 cochleates or 20 mg for 5:1 cochleates) was then dissolved in 1 mL DMSO. The DMSO solution was slowly added to the liposomal solution. After the caspofungin/soy PS liposomal solution was mixed, 1.5 mL of 0.1M calcium chloride solution was added at a rate of 10 μl/10 s in order to precipitate a solid. Resulting formulations, along with observations about cochleate morphology are presented in Table 1, below.
Cochleates Formed with Calcium—Aqueous Method
Numerous formulations using the aqueous drip method were prepared using varying combinations of starting materials. Soy phosphatidylserine (Soy PS, Degussa) and DOPS were both used as the starting lipid material for cochleate formulations using the aqueous drip method. Soy PS or DOPS (100 mg) was mixed with 5 mL water, saline, or buffer and the mixture was vortexed until liposomes formed. Protonized caspofungin (10 mg for 10:1 cochleates, 20 mg for 5:1 cochleates) was then dissolved in 5 mL water, saline, or buffer. The caspofungin solution was added slowly to the liposomal solution. After mixing, 1.5 mL of a 0.1 M calcium chloride solution was added to the caspofungin/soy PS liposomal solution at a rate of 10 μl/10 s in order to precipitate a solid caspofungin cochleate. Resultant formulations, along with observations about cochleate morphology and measurements of “free” caspofungin are presented in Table 1, below.
TABLE 1
Caspofungin cochleate formulations
“free”
PS:caspo
PS
Buffer/saline/
Morphology
caspo-
Method
(w/w)
source
water
(+/−EDTA)
fungin
DMSO
20:1
soy PS
water or saline
OK
ND
drip
10:1
soy PS
water or saline
OK
ND
5:1
soy PS
water or saline
OK
ND
aqueous
10:1
DOPS
water
OK
15%
drip
10:1
DOPS
saline
OK
4%
10:1
soy PS
water
OK
2%
10:1
soy PS
TES buffer
OK
2%
10:1
soy PS
saline
OK
0.1%
5:1
soy PS
saline
OK
1%
*“free” caspo indicates caspofungin which did not precipitate with the soy PS.
Briefly, the morphology of formulations made with both the solvent drip method and the aqueous drip method were indicative of cochleate structures. That is, they both demonstrated an opening to liposomes upon addition of EDTA. Additionally, it appears that the use of saline diminished the amount of free caspofungin in comparison to the use of water when cochleates were formulated using the aqueous drip method.
Cochleates Formed with Additional Acidification Step
100 mg soy PS was combined with 5 mL saline, and the mixture was vortexed until liposomes formed. 50 mg protonized caspofungin was then combined with 5 mL saline buffer at pH 5.5. This pH ensured that the caspofungin remained protonized and multivalent. The caspofungin solution was slowly added to the soy PS liposomes. Cochleates began to form immediately upon addition of caspofungin because of the high valency of the protonized moiety.
These cochleates were also formed with additional calcium, and with sterile water instead of saline. These three formulations were then maintained at 4° C. for five days in order to test the stability of the resultant cochleates. HPLC analysis of the cochleates and the supernatant was completed to measure concentration of caspofungin in both, and is summarized in FIG. 56. It is shown that in sterile water, the concentration of caspofungin in the cochleate gradually decreases, while the concentration of caspofungin not associated with a cochleate (“free caspofungin”) increases. This decrease of caspofungin in the cochleates and increase in free caspofungin can also be observed for the saline formulation with excess calcium. The formulation with saline only, however, remained stable over the five day period.
Acidification of Solution Subsequent to Cochleate Formation
Caspofungin cochleates formed with an alternative acidification step (pH 5.5) as described above were subsequently treated with varying amounts of sodium hydroxide and hydrochloric acid in order to vary the pH from 1 to 9 (pH tested with litmus paper). Phase contrast micrographs at pH 1, 4, 6, 7, 8, and 9 are depicted in FIG. 57. It appears that the formulations at pH 4 and pH 6 are cochleates, but open to form liposomes when the pH is raised to 9.
Addition of Bovine Serum Albumen to Caspofungin Cochleates
The particle size distribution of 10:1 and 5:1 PS:caspofumgin cochleates was measured using diffraction-based light-scattering from 0.5 to 500 microns with Beckman-Coulter LS230. FIGS. 53A and 53B (Vanco) are two graphs depicting the particle size distributions of 10:1 PS:caspofumgin cochleates and 5:1 PS:caspofungin cochleates, respectively. The 10:1 PS:caspofungin formulation was then treated with bovine serum albumin (BSA), followed by C-5 homogenization in order to reduce the mean particle size of the cochleates. Once again, the particle size distribution of the caspofungin cochleates was measured. FIG. 54 depicts the particle size distribution of the caspofungin cochleates, and demonstrates the decrease in particle size upon homogenization and addition of the BSA.
Example 26
Characterization of Caspofungin Cochleates
Caspofungin cochleates with a lipid:caspo ratio of 10:1 and 5:1 formulated as described in Example 25, using saline (0.9% NaCl), with additional Vitamin E (1% w/w, Roche) added at the liposomal stage, were characterized physically and chemically.
Morphology
The morphology of 10:1 and 5:1 caspofungin cochleates was observed using phase contrast microscopy and are shown in FIGS. 51A and 52A, respectively. EDTA was also added to the caspofungin cochleates of the same formulations in order to observe the opening of the cochleate structures. Phase contrast micrographs are given in FIGS. 51B and 52B, and show the cochleates opening to form liposomes.
Chemical Characterization
Concentrations of caspofungin in both the supernatant (to determine “free” caspofungin) and in the pellet (encochleated caspofungin) were measured using HPLC (FIG. 55), and the concentration of soy PS was determined using a modified Bartlett Pi assay. The PS:caspofungin ratio in the cochleates was determined using these values. The concentration of free caspofungin in both the 10:1 formulations and the 5:1 formulations ranged from approximately 0.7% to approximately 8.2% of total caspofungin. A sterility test for bacterial growth on agar plates was also investigated, and it was determined that all formulations passed.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
|
11653434
|
biodelivery sciences international, inc.
|
USA
|
B2
|
Utility Patent Grant (with pre-grant publication) issued on or after January 2, 2001.
|
Open
|
424/450
|
|
Mar 30th, 2022 06:04PM
|
Mar 30th, 2022 06:04PM
|
BioDelivery Sciences
|
|
Pharmaceuticals & Biotechnology
|
|
nasdaq:bdsi
|
BioDelivery Sciences
|
Mar 21st, 2017 12:00AM
|
Jun 30th, 2016 12:00AM
|
https://www.uspto.gov?id=US09597288-20170321
|
Transmucosal delivery devices with enhanced uptake
|
The present invention provides methods for enhancing transmucosal uptake of a medicament, e.g., fentanyl or buprenorphine, to a subject and related devices. The method includes administering to a subject a transmucosal drug delivery device comprising the medicament. Also provided are devices suitable for transmucosal administration of a medicament to a subject and methods of their administration and use. The devices include a medicament disposed in a mucoadhesive polymeric diffusion environment and a barrier environment.
|
9597288
|
1. A method for delivering fentanyl to a human comprising:
administering a mucoadhesive biodegradable drug delivery device for transmucosal delivery to the oral mucosa of said human, the device comprising:
a biodegradable mucoadhesive layer comprising fentanyl disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH of between about 6 and about 8.5; and
a polymeric barrier environment disposed adjacent to the mucoadhesive layer, wherein a unidirectional diffusion gradient of fentanyl is provided upon application to a buccal surface,
wherein the overall bioavailability of fentanyl is at least about 60%; and
wherein the fentanyl is delivered in less than about 30 minutes.
2. The method of claim 1, wherein the overall bioavailability of fentanyl is at least about 70%.
3. The method of claim 1, wherein the polymeric diffusion environment comprises at least one film-forming water-erodible adhesive polymer and at least one bioadhesive polymer.
4. The method of claim 1, wherein said polymeric barrier environment comprises at least one film-forming water-erodible polymer.
5. The method of claim 1, wherein the polymeric diffusion environment has a pH of between about 7 to about 7.5.
6. The method of claim 1, wherein the mucoadhesive biodegradable drug delivery device further comprises an opioid antagonist.
7. The method of claim 1, wherein the biodegradable drug delivery device further comprises a third layer or coating.
8. The method of claim 1, wherein the polymeric diffusion environment has a pH buffered to between about 6 and about 8.5.
9. The method of claim 1, wherein the polymeric diffusion environment has a pH buffered to between about 7 to about 7.5.
10. The method of claim 8, wherein the overall bioavailability of fentanyl is at least about 70%.
11. The method of claim 8, wherein the polymeric diffusion environment comprises at least one film-forming water-erodible adhesive polymer and at least one bioadhesive polymer.
12. The method of claim 8, wherein said polymeric barrier environment comprises at least one film-forming water-erodible polymer.
13. The method of claim 8, wherein the mucoadhesive biodegradable drug delivery device further comprises an opioid antagonist.
14. The method of claim 8, wherein the biodegradable drug delivery device further comprises a third layer or coating.
15. A device for delivering fentanyl to a human, the device comprising:
a biodegradable mucoadhesive layer comprising fentanyl disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH of between about 6 and about 8.5; and
a polymeric barrier environment disposed adjacent to the mucoadhesive layer, wherein a unidirectional diffusion gradient of fentanyl is provided upon application to a buccal surface of a subject,
wherein upon application to a buccal surface, the overall bioavailability of fentanyl is at least about 60%; and
wherein the fentanyl is delivered in less than about 30 minutes.
16. The device of claim 15, wherein the overall bioavailability of fentanyl is at least about 70%.
17. The device of claim 15, wherein the polymeric diffusion environment comprises at least one film-forming water-erodible adhesive polymer and at least one bioadhesive polymer.
18. The device of claim 15, wherein said polymeric barrier environment comprises at least one film-forming water-erodible polymer.
19. The device of claim 15, wherein the polymeric diffusion environment has a pH of between about 7 to about 7.5.
20. The device of claim 15, wherein the mucoadhesive biodegradable drug delivery device further comprises an opioid antagonist.
21. The device of claim 15, wherein the biodegradable drug delivery device further comprises a third layer or coating.
22. The device of claim 15, wherein the polymeric diffusion environment has a pH buffered to between about 6 and about 8.5.
23. The device of claim 15, wherein the polymeric diffusion environment has a pH buffered to between about 7 to about 7.5.
24. The device of claim 22, wherein the overall bioavailability of fentanyl is at least about 70%.
25. The device of claim 22, wherein the polymeric diffusion environment comprises at least one film-forming water-erodible adhesive polymer and at least one bioadhesive polymer.
26. The device of claim 22, wherein said polymeric barrier environment comprises at least one film-forming water-erodible polymer.
27. The device of claim 22, wherein the mucoadhesive biodegradable drug delivery device further comprises an opioid antagonist.
28. The device of claim 27, wherein said opioid antagonist is naloxone.
29. The device of claim 22, wherein the biodegradable drug delivery device further comprises a third layer or coating.
30. A method for treating pain, the method comprising:
adhering a mucoadhesive biodegradable drug delivery device to a buccal surface of a human, the device comprising:
a biodegradable mucoadhesive layer comprising a therapeutically effective amount of fentanyl for treating pain disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH buffered to between about 6 and about 8.5; and
a polymeric barrier environment disposed adjacent to the mucoadhesive layer wherein a unidirectional diffusion gradient of fentanyl is provided upon application to the buccal surface,
wherein the transmucosal delivery of fentanyl is at least about 50% by direct buccal absorption,
wherein the overall bioavailability of fentanyl is at least about 70%; and
wherein the fentanyl is delivered in less than about 30 minutes.
|
30
|
RELATED APPLICATIONS
This application is a continuation of U.S. patent application Ser. No. 14/746,168 filed Jun. 22, 2015, which is a continuation of U.S. patent application Ser. No. 13/413,112, filed Mar. 6, 2012, which is a continuation of U.S. patent application Ser. No. 13/184,306, filed Jun. 15, 2011, which is a continuation of U.S. patent application Ser. No. 11/817,915, filed Oct. 6, 2009, which is a U.S. National Phase of PCT/US2007/016634, filed Jul. 23, 2007. PCT/US2007/016634 claims priority to U.S. Provisional Application No. 60/832,725, filed Jul. 21, 2006, U.S. Provisional Application No. 60/832,726, filed Jul. 21, 2006, and U.S. Provisional Application No. 60/839,504, filed Aug. 23, 2006. The entire contents of these applications are incorporated herein by reference. This application is also related to U.S. Ser. No. 11/639,408, filed Dec. 13, 2006, and PCT/US2006/47686, also filed Dec. 13, 2006, both of which claim priority to U.S. Provisional Application No. 60/750,191, filed Dec. 13, 2005, and 60/764,618, filed Feb. 2, 2006. The entire contents of these applications are also incorporated herein by this reference.
BACKGROUND
U.S. Pat. No. 6,264,981 (Zhang et al.) describes delivery devices, e.g., tablets of compressed powders that include a solid solution micro-environment formed within the drug formulation. The micro-environment includes a solid pharmaceutical agent in solid solution with a dissolution agent that that facilitates rapid dissolution of the drug in the saliva. The micro-environment provides a physical barrier for preventing the pharmaceutical agent from being contacted by other chemicals in the formulation. The micro-environment may also create a pH segregation in the solid formulation. The pH of the micro-environment is chosen to retain the drug in an ionized form for stability purposes. The rest of the formulation can include buffers so that, upon dissolution in the oral cavity, the pH is controlled in the saliva such that absorption of the drug is controlled.
US Publication 2004/0253307 also describes solid dosage forms that include buffers that upon dissolution of the solid dosage form maintains the pharmaceutical agent at a desired pH to control absorption, i.e., to overcome the influence of conditions in the surrounding environment, such as the rate of saliva secretion, pH of the saliva and other factors.
BRIEF SUMMARY OF THE INVENTION
The present invention provides transmucosal devices for enhanced uptake of a medicament and methods of making and using the same. In some embodiments, the devices generally include a mucoadhesive polymeric diffusion environment that facilitates not only the absorption of the medicament across the mucosal membrane to which it is applied, but additionally, the permeability and/or motility of the medicament through the mucoadhesive polymeric diffusion environment to the mucosa.
Accordingly, in one embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of a fentanyl or fentanyl derivative to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: a fentanyl or fentanyl derivative disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface and the fentanyl or fentanyl derivative is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of a fentanyl or fentanyl derivative disposed in a mucoadhesive polymeric diffusion environment such that the effective amount of the fentanyl or fentanyl derivative is delivered in less than about 30 minutes. In some embodiments, chronic pain is alleviated in the subject. In other embodiments, acute pain is alleviated in the subject. In other embodiments, the pain is breakthrough cancer pain.
In yet another embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of a fentanyl or fentanyl derivative to a subject. The mucoadhesive device generally includes a fentanyl or fentanyl derivative disposed in a polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is upon application to a mucosal surface.
In another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative with at least 50% direct buccal absorption and an absolute bioavailability of at least about 70%. In yet another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative directly to the mucosa to achieve onset of pain relief (Tfirst) of about 0.20 hours or less and time to peak plasma concentration (Tmax) of about 1.6 hours or more. In still another embodiment, the present invention is directed to devices comprising about 800 μg of fentanyl, which exhibit upon transmucosal administration to a subject at least one in vivo plasma profile as follows: a Cmax of about 1.10 ng/mL or more; a Tfirst of about 0.20 hours or less; and an AUC0-24 of about 10.00 hr ng/mL or more. In yet another embodiment, the present invention is directed to transmucosal delivery devices which include a fentanyl or fentanyl derivative that delivers the fentanyl or fentanyl derivative in an amount effective to treat pain, wherein oral irritation, oral ulceration and/or constipation associated with the delivery of the fentanyl or fentanyl derivative is insignificant or eliminated. In one embodiment, the pH of the mucoadhesive polymeric diffusion environment is between about 6.5 and about 8, e.g., about 7.25. In one embodiment, the device comprises about 800 μg of fentanyl. In another embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the fentanyl or fentanyl derivative to the mucosa. In another embodiment, the fentanyl is fentanyl citrate.
In one embodiment, more than 30% of the fentanyl, e.g., more than 55% of the fentanyl, in the device becomes systemically available via mucosal absorption.
In one embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of buprenorphine to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: buprenorphine disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface, and the buprenorphine is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of buprenorphine disposed in a mucoadhesive polymeric diffusion environment such that the effective amount of the buprenorphine is delivered in less than about 30 minutes. In some embodiments, chronic pain is alleviated in the subject. In other embodiments, acute pain is alleviated in the subject. In other embodiments, the pain is breakthrough cancer pain.
In yet another embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of buprenorphine to a subject. The mucoadhesive device generally includes buprenorphine disposed in a polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to a mucosal surface. In one embodiment, the pH is between about 4.0 and about 7.5, e.g., about 6.0 or about 7.25. In another embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the buprenorphine to the mucosa.
In one embodiment of the methods and devices of the present invention, the device comprises a pH buffering agent. In one embodiment of the methods and devices of the present invention, the device is adapted for buccal administration or sublingual administration.
In one embodiment of the methods and devices of the present invention, the device is a mucoadhesive disc. In one embodiment of the methods and devices of the present invention, the medicament is formulated as a mucoadhesive film formed to delineate different dosages. In one embodiment of the methods and devices of the present invention, the device comprises a backing layer disposed adjacent to the mucoadhesive polymeric diffusion environment.
In one embodiment of the methods and devices of the present invention, the device further comprises an opioid antagonist. In one embodiment of the methods and devices of the present invention, the device further comprises naloxone.
In one embodiment of the methods and devices of the present invention, the device is a layered, flexible device. In one embodiment of the methods and devices of the present invention, the mucoadhesive polymeric diffusion environment has a buffered environment for the transmucosal administration.
In one embodiment of the methods and devices of the present invention, there is substantially no irritation at the site of transmucosal administration. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 30 minutes.
In one embodiment of the methods and devices of the present invention, the polymeric diffusion environment comprises at least one ionic polymer system, e.g., polyacrylic acid (optionally crosslinked), sodium carboxymethylcellulose and mixtures thereof. In one embodiment, the polymeric diffusion environment comprises a buffer system, e.g., citric acid, sodium benzoate or mixtures thereof. In some embodiments, the device has a thickness such that it exhibits minimal mouth feel. In some embodiments, the device has a thickness of about 0.25 mm.
In some embodiments, the present invention provides a flexible, bioerodable mucoadhesive delivery device suitable for direct transmucosal administration of an effective amount of a fentanyl, fentanyl derivative, buprenorphine or buprenorphine derivative to a subject. The mucoadhesive device includes a mucoadhesive layer comprising a fentanyl, fentanyl derivative, buprenorphine or buprenorphine derivative disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH of about 7.25 for the fentanyl or fentanyl derivative or a pH of about 6 for the buprenorphine or buprenorphine derivative; and a backing layer comprising a barrier environment which is disposed adjacent to and coterminous with the mucoadhesive layer. The device has no or minimal mouth feel and is able to transmucosally deliver the effective amount of the, fentanyl derivative, buprenorphine or buprenorphine derivative in less than about 30 minutes; and wherein a unidirectional gradient is created upon application of the device to a mucosal surface.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other aspects, embodiments, objects, features and advantages of the invention can be more fully understood from the following description in conjunction with the accompanying figures.
FIGS. 1 and 2 are graphs comparing fentanyl citrate uptake in humans over 2 days post-administration, and 1 hour post-administration, respectively, for exemplary embodiments of the present invention and a commercially available delivery device (Actiq® Oral Transmucosal Fentanyl Citrate) as described in Examples 1 and 2.
FIG. 3 is a graph comparing buprenorphine uptake in humans over 16 hours post-administration, respectively, for exemplary embodiments of the present invention and a commercially available delivery devices as described in Examples 3 and 4.
FIGS. 4A-C are schematic representations of exemplary embodiments of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based, at least in part, on the discovery that transmucosal uptake of medicaments can be enhanced by employing a novel polymeric diffusion environment. Such a polymeric diffusion environment is advantageous, e.g., because the absolute bioavailability of the medicament contained therein is enhanced, while also providing a rapid onset. Additionally, less medicament is needed in the device to deliver a therapeutic effect versus devices of the prior art. This renders the device less abusable, an important consideration when the medicament is a controlled substance, such as an opioid. The polymeric diffusion environment described in more detail herein, provides an enhanced delivery profile and more efficient delivery of the medicament. Additional advantages of a polymeric diffusion environment are also described herein.
In order to more clearly and concisely describe the subject matter of the claims, the following definitions are intended to provide guidance as to the meaning of terms used herein.
As used herein, the articles “a” and “an” mean “one or more” or “at least one,” unless otherwise indicated. That is, reference to any element of the present invention by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present.
As used herein, the term “acute pain” refers to pain characterized by a short duration, e.g., three to six months. Acute pain is typically associated with tissue damage, and manifests in ways that can be easily described and observed. It can, for example, cause sweating or increased heart rate. Acute pain can also increase over time, and/or occur intermittently.
As used herein, the term “chronic pain” refers to pain which persists beyond the usual recovery period for an injury or illness. Chronic pain can be constant or intermittent. Common causes of chronic pain include, but are not limited to, arthritis, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), repetitive stress injuries, shingles, headaches, fibromyalgia, and diabetic neuropathy.
As used herein, the term “breakthrough pain” refers to pain characterized by frequent and intense flares of moderate to severe pain which occur over chronic pain, even when a subject is regularly taking pain medication. Characteristics of breakthrough pain generally include: a short time to peak severity (e.g., three to five minutes); excruciating severity; relatively short duration of pain (e.g., 15 to 30 minutes); and frequent occurrence (e.g., one to five episodes a day). Breakthrough pain can occur unexpectedly with no obvious precipitating event, or it can be event precipitated. The occurrence of breakthrough pain is predictable about 50% to 60% of the time. Although commonly found in patients with cancer, breakthrough pain also occurs in patients with lower back pain, neck and shoulder pain, moderate to severe osteoarthritis, and patients with severe migraine.
As used herein, unless indicated otherwise, the term “fentanyl”, includes any pharmaceutically acceptable form of fentanyl, including, but not limited to, salts, esters, and prodrugs thereof. The term “fentanyl” includes fentanyl citrate. As used herein, the term “fentanyl derivative” refers to compounds having similar structure and function to fentanyl. In some embodiments, fentanyl derivatives include those of the following formula:
or pharmaceutically acceptable salts or esters thereof, wherein
R1 is selected from an aryl group, a heteroaryl group or a —COO—C1-4 alkyl group; and R2 is selected from —H, a —C1-4 alkyl-O—C1-4 alkyl group or a —COO—C1-4 alkyl group.
Fentanyl derivatives include, but are not limited to, alfentanil, sufentanil, remifentanil and carfentanil.
As used herein, unless indicated otherwise, the term “buprenorphine”, includes any pharmaceutically acceptable form of buprenorphine, including, but not limited to, salts, esters, and prodrugs thereof. As used herein, the term “buprenorphine derivative” refers to compounds having similar structure and function to buprenorphine. In some embodiments, fentanyl derivatives include those of the following formula:
or pharmaceutically acceptable salts or esters thereof, wherein
is a double or single bond; R3 is selected from a —C1-4 alkyl group or a cycloalkyl-substituted-C1-4 alkyl group; R4 is selected from a —C1-4 alkyl; R5 is —OH, or taken together, R4 and R5 form a ═O group; and R6 is selected from —H or a —C1-4 alkyl group.
Buprenorphine derivatives include, but are not limited to, etorphine and diprenorphine.
As used herein, “polymeric diffusion environment” refers to an environment capable of allowing flux of a medicament to a mucosal surface upon creation of a gradient by adhesion of the polymeric diffusion environment to a mucosal surface. The flux of a transported medicament is proportionally related to the diffusivity of the environment which can be manipulated by, e.g., the pH, taking into account the ionic nature of the medicament and/or the ionic nature polymer or polymers included in the environment and.
As used herein, “barrier environment” refers to an environment in the form of, e.g., a layer or coating, capable of slowing or stopping flux of a medicament in its direction. In some embodiments, the barrier environment stops flux of a medicament, except in the direction of the mucosa. In some embodiments, the barrier significantly slows flux of a medicament, e.g., enough so that little or no medicament is washed away by saliva.
As used herein, the term “unidirectional gradient” refers to a gradient which allows for the flux of a medicament (e.g., fentanyl or buprenorphine) through the device, e.g., through a polymeric diffusion environment, in substantially one direction, e.g., to the mucosa of a subject. For example, the polymeric diffusion environment may be a mucoadhesive polymeric diffusion environment in the form of a layer or film disposed adjacent to a backing layer or film. Upon mucoadministration, a gradient is created between the mucoadhesive polymeric diffusion environment and the mucosa, and the medicament flows from the mucoadhesive polymeric diffusion environment, substantially in one direction towards the mucosa. In some embodiments, some flux of the medicament is not entirely unidirectional across the gradient; however, there is typically not free flux of the medicament in all directions. Such unidirectional flux is described in more detail herein, e.g., in relation to FIG. 4.
As used herein, “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of preventing, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder (e.g., to alleviate pain).
The term “subject” refers to living organisms such as humans, dogs, cats, and other mammals. Administration of the medicaments included in the devices of the present invention can be carried out at dosages and for periods of time effective for treatment of a subject. In some embodiments, the subject is a human. In some embodiments, the pharmacokinetic profiles of the devices of the present invention are similar for male and female subjects. An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
The term “transmucosal,” as used herein, refers to any route of administration via a mucosal membrane. Examples include, but are not limited to, buccal, sublingual, nasal, vaginal, and rectal. In one embodiment, the administration is buccal. In one embodiment, the administration is sublingual. As used herein, the term “direct transmucosal” refers to mucosal administration via the oral mucosa, e.g., buccal and/or sublingual.
As used herein, the term “water erodible” or “at least partially water erodible” refers to a substance that exhibits a water erodibility ranging from negligible to completely water erodible. The substance may readily dissolve in water or may only partially dissolve in water with difficulty over a long period of time. Furthermore, the substance may exhibit a differing erodibility in body fluids compared with water because of the more complex nature of body fluids. For example, a substance that is negligibly erodible in water may show an erodibility in body fluids that is slight to moderate. However, in other instances, the erodibility in water and body fluid may be approximately the same.
The present invention provides transmucosal delivery devices that uniformly and predictably deliver a medicament to a subject. The present invention also provides methods of delivery of a medicament to a subject employing devices in accordance with the present invention. Accordingly, in one embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of a medicament, e.g., fentanyl or fentanyl derivative or buprenorphine to a subject. The mucoadhesive device generally includes a medicament disposed in a polymeric diffusion environment; and a having a barrier such that a unidirectional gradient is created upon application to a mucosal surface, wherein the device is capable of delivering in a unidirectional manner the medicament to the subject. The present invention also provides methods of delivery of a medicament to a subject employing the devices in accordance with the present invention.
In another embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of a medicament, e.g., fentanyl, fentanyl derivatives and/or buprenorphine, to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: a medicament disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface, wherein an effective amount of the medicament is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of a medicament, e.g., fentanyl, fentanyl derivatives and/or buprenorphine, disposed in a mucoadhesive polymeric diffusion environment having a thickness such that the effective amount of the medicament is delivered in less than about 30 minutes and such that pain is treated. In some embodiments, the medicament is delivered in less than about 25 minutes. In some embodiments, the medicament is delivered in less than about 20 minutes.
In some embodiments of the above methods and devices, an effective amount is delivered transmucosally. In other embodiments, an effective amount is delivered transmucosally and by gastrointestinal absorption. In still other embodiments, an effective amount is delivered transmucosally, and delivery though the gastrointestinal absorption augments and/or maintains treatment, e.g., pain relief for a desired period of time, e.g., at least 1, 1.5, 2, 2.5, 3, 3.5, or 4 or more hours.
In yet another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative directly to the mucosa to achieve onset of pain relief (Tfirst) of about 0.20 hours or less and time to peak plasma concentration (Tmax) of about 1.6 hours or more. The combination of a rapid onset with a delayed maximum concentration is particularly advantageous when treating pain, e.g., relief for breakthrough cancer pain (BTP) in opioid tolerant patients with cancer, because immediate relief is provided to alleviate a flare of moderate to severe pain but persistence is also provided to alleviate subsequent flares. Conventional delivery systems may address either the immediate relief or subsequent flare-ups, but the devices of this embodiment are advantageous because they address both.
TABLE 1
Selected Pharmacokinetic properties of transmucosal devices.
Total
Tfirst
Tmax
Bioavailability
BEMA pH 7.25
0.15 hours
1.61 hours
70%
Actiq ®
0.23 hours
2.28 hours
47%
Fentora ®
0.25 hours*
0.50 hours
65%
*reported as onset of main relief, first time point measured.
The devices of the present invention may have a number of additional or alternative desirable properties, as described in more detail herein. Accordingly, in another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative with at least 50% direct buccal absorption and an absolute bioavailability of at least about 70%. In still another embodiment, the present invention is directed to devices comprising about 800 μg of fentanyl, which exhibit upon transmucosal administration to a subject at least one in vivo plasma profile as follows: a Cmax of about 1.10 ng/mL or more; a Tfirst of about 0.20 hours or less; and an AUC0-24 of about 10.00 hr·ng/mL or more.
The pain can be any pain known in the art, caused by any disease, disorder, condition and/or circumstance. In some embodiments, chronic pain is alleviated in the subject using the methods of the present invention. In other embodiments, acute pain is alleviated in the subject using the methods of the present invention. Chronic pain can arise from many sources including, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), and migraine. Acute pain is typically directly related to tissue damage, and lasts for a relatively short amount of time, e.g., three to six months. In other embodiments, the pain is breakthrough cancer pain. In some embodiments, the methods and devices of the present invention can be used to alleviate breakthrough pain in a subject. For example, the devices of the present invention can be used to treat breakthrough pain in a subject already on chronic opioid therapy. In some embodiments, the devices and methods of the present invention provide rapid analgesia and/or avoid the first pass metabolism of fentanyl, thereby resulting in more rapid breakthrough pain relief than other treatments, e.g., oral medications.
In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 60% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 70% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 80% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 90% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 100% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 25 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 20 minutes.
Without wishing to be bound by any particular theory, it is believed that delivery of the medicament is particularly effective because the mucoadhesive polymeric diffusion environment (e.g., the pH and the ionic nature of the polymers) is such that the medicament (e.g., a weakly basic drug such as fentanyl or buprenorphine) can rapidly move through the mucoadhesive polymeric diffusion environment to the mucosa, while also allowing efficient absorption by the mucosa. For example, in some embodiments, the pH is low enough to allow movement of the medicament, while high enough for absorption.
In some embodiments, the mucoadhesive polymeric diffusion environment is a layer with a buffered pH such that a desired pH is maintained at the mucosal administration site. Accordingly, the effect of any variation in pH encountered in a subject or between subjects (e.g., due to foods or beverages recently consumed), including any effect on uptake, is reduced or eliminated.
Accordingly, one advantage of the present invention is that variability in the properties of the device (e.g., due to changes in the pH of the ingredients) between devices, and from lot to lot is reduced or eliminated. Without wishing to be bound by any particular theory, it is believed that the polymeric diffusion environment of the present invention reduces variation, e.g., by maintaining a buffered pH. Yet another advantage is pH variability at the administration site (e.g., due to what food or drink or other medications was recently consumed) is reduced or eliminated, such that, e.g., the variability of the devices is reduced or eliminated.
A medicament for use in the present invention includes any medicament capable of being administered transmucosally. The medicament can be suitable for local delivery to a particular mucosal membrane or region, such as the buccal and nasal cavities, throat, vagina, alimentary canal or the peritoneum. Alternatively, the medicament can be suitable for systemic delivery via such mucosal membranes.
In one embodiment, the medicament can be an opioid. Opioids suitable for use in the present invention include, e.g., alfentanil, allylprodine, alphaprodine, apomorphine, anileridine, apocodeine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, cyclorphan, cyprenorphine, desomorphine, dextromoramide, dextropropoxyphene, dezocine, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, eptazocine, ethylmorphine, etonitazene, etorphine, fentanyl, fencamfamine, fenethylline, hydrocodone, hydromorphone, hydroxymethylmorphinan, hydroxypethidine, isomethadone, levomethadone, levophenacylmorphan, levorphanol, lofentanil, mazindol, meperidine, metazocine, methadone, methylmorphine, modafinil, morphine, nalbuphene, necomorphine, normethadone, normorphine, opium, oxycodone, oxymorphone, pholcodine, profadol remifentanil, sufentanil, tramadol, corresponding derivatives, physiologically acceptable compounds, salts and bases. In some embodiments, the medicament is fentanyl, e.g., fentanyl citrate. In some embodiments, the medicament is buprenorphine.
The amount of medicament, e.g. fentanyl or buprenorphine, to be incorporated into the device of the present invention depends on the desired treatment dosage to be administered, e.g., the fentanyl or fentanyl derivative can be present in about 0.001% to about 50% by weight of the device of the present invention, and in some embodiments between about 0.005 and about 35% by weight or the buprenorphine can be present in about 0.001% to about 50% by weight of the device of the present invention, and in some embodiments between about 0.005 and about 35% by weight. In one embodiment, the device comprises about 3.5% to about 4.5% fentanyl or fentanyl derivative by weight. In one embodiment, the device comprises about 3.5% to about 4.5% buprenorphine by weight. In another embodiment, the device comprises about 800 μg of a fentanyl such as fentanyl citrate. In another embodiment the device comprises about 25, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, 1600 or 2000 μg of a fentanyl such as fentanyl citrate or fentanyl derivative. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention. In another embodiment, the device comprises about 800 μg of buprenorphine. In another embodiment the device comprises about 100, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, or 2000 μg of buprenorphine. In another embodiment the device comprises about 25, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, 1600 or 2000 μg of any of the medicaments described herein.
One approach to reaching an effective dose is through titration with multiple dosage units such that patients start with a single 200 mcg unit and progressively increase the number of units applied until reaching an effective dose or 800 mcg (4 units) dose as the multiple discs once an effective dose has been identified. Accordingly, in some embodiments, the methods of the present invention also include a titration phase to identify a dose that relieves pain and produces minimal toxicity, because the dose of opioid, e.g., fentanyl, required for control of breakthrough pain episodes is often not easily predicted. The linear relationship between surface area of the devices of the present invention and pharmacokinetic profile may be exploited in the dose titration process through the application of single or multiple discs to identify an appropriate dose, and then substitution of a single disc containing the same amount of medicament.
In one embodiment, the devices of the present invention are capable of delivering a greater amount of fentanyl systemically to the subject than conventional devices. According to the label for Actiq® Oral Transmucosal Fentanyl Citrate, approximately 25% of the fentanyl in the ACTIQ product is absorbed via the buccal mucosa, and of the remaining 75% that is swallowed, another 25% of the total fentanyl becomes available via absorption in the GI tract for a total of 50% total bioavailability. According to Fentora Fentanyl Buccal tablet literature, approximately 48% of the fentanyl in FENTORA product is absorbed via the buccal mucosa, and of the remaining 52%, another 17% of the total fentanyl becomes available via absorption in the GI tract for a total of 65% total bioavailability. Accordingly, in some embodiments, more than about 30% of the fentanyl disposed in the devices of the present invention becomes systemically available or bioavailable via absorption by the mucosa. In some embodiments, more than about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% becomes systemically available via mucosal absorption. In some embodiments, more than about 55%, 60%, 65% or 70% of the fentanyl disposed in the devices of the present invention becomes systemically available or bioavailable by any route, mucosal and/or GI tract. In some embodiments, more than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% becomes systemically available.
Accordingly, another advantage of the devices and methods of the present invention is that because the devices of the present invention more efficiently deliver the medicament, e.g., fentanyl or buprenorphine, than do conventional devices, less medicament can be included than must be included in conventional devices to deliver the same amount of medicament. Accordingly, in some embodiments, the devices of the present invention are not irritating to the mucosal surface on which it attaches. In some embodiments, the devices of the present invention cause little or no constipation, even when the devices include an opioid antagonist such as naloxone. In yet another embodiment, the present invention is directed to transmucosal delivery devices which include a fentanyl or fentanyl derivative that delivers the fentanyl or fentanyl derivative in an amount effective to treat pain, wherein oral irritation, oral ulceration and/or constipation associated with the delivery of the fentanyl or fentanyl derivative is not significant or eliminated.
Another advantage is the devices of the present invention are less subject to abuse than conventional devices because less medicament, e.g., fentanyl or buprenorphine, is required in the device, i.e., there is less medicament to be extracted by an abuser for injection into the bloodstream.
In some embodiments, the devices of the present invention have a dose response that is substantially directly proportional to the amount of medicament present in the device. For example, if the Cmax is 10 ng/mL for a 500 dose, then it is expected in some embodiments that a 1000 μg dose will provide a Cmax of approximately 20 ng/mL. Without wishing to be bound by any particular theory, it is believed that this is advantageous in determining a proper dose in a subject.
In some embodiments, the devices of the present invention further comprise an opioid antagonist in any of various forms, e.g., as salts, bases, derivatives, or other corresponding physiologically acceptable forms. Opioid antagonists for use with the present invention include, but are not limited to, naloxone, naltrexone, nalmefene, nalide, nalmexone, nalorphine, naluphine, cyclazocine, levallorphan and physiologically acceptable salts and solvates thereof, or combinations thereof. In one embodiment, the device further comprises naloxone.
In some embodiments, the properties of the polymeric diffusion environment are effected by its pH. In one embodiment, e.g., when the medicament is fentanyl, the pH of the mucoadhesive polymeric diffusion environment in the devices of the present invention is between about 6.5 and about 8. In another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 7.25. In another embodiment, the pH is between about 7.0 and about 7.5, or between about 7.25 and 7.5. In other embodiments, the pH is about 6.5, 7.0, 7.5, 8.0 or 8.5, or any incremental value thereof. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
In one embodiment, e.g., when the medicament is buprenorphine, the pH of the mucoadhesive polymeric diffusion environment in the devices of the present invention is between about 4.0 and about 7.5. In another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 6.0. In one embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 5.5 to about 6.5, or between about 6.0 and 6.5. In yet another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 7.25. In another embodiment, the pH is between about 7.0 and 7.5, or between about 7.25 and 7.5. In other embodiments, the pH of the device may be about 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, or 7.5, or any incremental value thereof. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
The pH of the mucoadhesive polymeric diffusion environment can be adjusted and/or maintained by methods including, but not limited to, the use of buffering agents, or by adjusting the composition of the device of the present invention. For example, adjustment of the components of the device of the present invention that influence pH, e.g., the amount of anti-oxidant, such as citric acid, contained in the device will adjust the pH of the device.
In some embodiments, the properties of the polymeric diffusion environment are effected by its buffering capacity. In some embodiments, buffering agents are included in the mucoadhesive mucoadhesive polymeric diffusion environment. Buffering agents suitable for use with the present invention include, for example, phosphates, such as sodium phosphate; phosphates monobasic, such as sodium dihydrogen phosphate and potassium dihydrogen phosphate; phosphates dibasic, such as disodium hydrogen phosphate and dipotassium hydrogen phosphate; citrates, such as sodium citrate (anhydrous or dehydrate); bicarbonates, such as sodium bicarbonate and potassium bicarbonate may be used. In one embodiment, a single buffering agent, e.g., a dibasic buffering agent is used. In another embodiment, a combination of buffering agents is employed, e.g., a combination of a tri-basic buffering agent and a monobasic buffering agent.
In one embodiment, the mucoadhesive polymeric diffusion environment of the device will have a buffered environment, i.e., a stabilized pH, for the transmucosal administration of a medicament. The buffered environment of the device allows for the optimal administration of the medicament to a subject. For example, the buffered environment can provide a desired pH at the mucosa when in use, regardless of the circumstances of the mucosa prior to administration.
Accordingly, in various embodiments, the devices include a mucoadhesive polymeric diffusion environment having a buffered environment that reduces or eliminates pH variability at the site of administration due to, for example, medications, foods and/or beverages consumed by the subject prior to or during administration. Thus, pH variation encountered at the site of administration in a subject from one administration to the next may have minimal or no effect on the absorption of the medicament. Further, pH variation at the administration site between different patients will have little or no effect on the absorption of the medicament. Thus, the buffered environment allows for reduced inter- and intra-subject variability during transmucosal administration of the medicament. In another embodiment, the present invention is directed to methods for enhancing uptake of a medicament that include administering to a subject a device including a medicament disposed in a mucoadhesive polymeric diffusion environment having a buffered environment for the transmucosal administration. In yet another embodiment, the present invention is directed to methods of delivering a therapeutically effective amount of a medicament to a subject that include administering a device including a medicament disposed in a mucoadhesive polymeric diffusion environment having a buffered environment for the transmucosal administration.
The devices of the present invention can include any combination or sub-combination of ingredients, layers and/or compositions of, e.g., the devices described in U.S. Pat. No. 6,159,498, U.S. Pat. No. 5,800,832, U.S. Pat. No. 6,585,997, U.S. Pat. No. 6,200,604, U.S. Pat. No. 6,759,059 and/or PCT Publication No. WO 05/06321. The entire contents of these patent and publications are incorporated herein by reference in their entireties.
In some embodiments, the properties of the polymeric diffusion environment are effected by the ionic nature of the polymers employed in the environment. In one embodiment, the mucoadhesive polymeric diffusion environment is water-erodible and can be made from a bioadhesive polymer(s) and optionally, a first film-forming water-erodible polymer(s). In one embodiment, the polymeric diffusion environment comprises at least one ionic polymer system, e.g., polyacrylic acid (optionally crosslinked), sodium carboxymethylcellulose and mixtures thereof.
In some embodiments, the mucoadhesive polymeric diffusion environment can include at least one pharmacologically acceptable polymer capable of bioadhesion (the “bioadhesive polymer”) and can optionally include at least one first film-forming water-erodible polymer (the “film-forming polymer”). Alternatively, the mucoadhesive polymeric diffusion environment can be formed of a single polymer that acts as both the bioadhesive polymer and the first film-forming polymer. Additionally or alternatively, the water-erodible mucoadhesive polymeric diffusion environment can include other first film-forming water-erodible polymer(s) and water-erodible plasticizer(s), such as glycerin and/or polyethylene glycol (PEG).
In some embodiments, the bioadhesive polymer of the water-erodible mucoadhesive polymeric diffusion environment can include any water erodible substituted cellulosic polymer or substituted olefinic polymer wherein the substituents may be ionic or hydrogen bonding, such as carboxylic acid groups, hydroxyl alkyl groups, amine groups and amide groups. For hydroxyl containing cellulosic polymers, a combination of alkyl and hydroxyalkyl groups will be preferred for provision of the bioadhesive character and the ratio of these two groups will have an effect upon water swellability and disperability. Examples include polyacrylic acid (PAA), which can optionally be partially crosslinked, sodium carboxymethyl cellulose (NaCMC), moderately to highly substituted hydroxypropylmethyl cellulose (HPMC), polyvinylpyrrolidone (PVP, which can optionally be partially crosslinked), moderately to highly substituted hydroxyethylmethyl cellulose (HEMC) or combinations thereof. In one embodiment, HEMC can be used as the bioadhesive polymer and the first film forming polymer as described above for a mucoadhesive polymeric diffusion environment formed of one polymer. These bioadhesive polymers are preferred because they have good and instantaneous mucoadhesive properties in a dry, system state.
The first film-forming water-erodible polymer(s) of the mucoadhesive polymeric diffusion environment can be hydroxyalkyl cellulose derivatives and hydroxyalkyl alkyl cellulose derivatives preferably having a ratio of hydroxyalkyl to alkyl groups that effectively promotes hydrogen bonding. Such first film-forming water-erodible polymer(s) can include hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropylmethyl cellulose (HPMC), hydroxyethylmethyl cellulose (HEMC), or a combination thereof. Preferably, the degree of substitution of these cellulosic polymers will range from low to slightly above moderate.
Similar film-forming water-erodible polymer(s) can also be used. The film-forming water-erodible polymer(s) can optionally be crosslinked and/or plasticized in order to alter its dissolution kinetics.
In some embodiments, the mucoadhesive polymeric diffusion environment, e.g., a bioerodable mucoadhesive polymeric diffusion environment, is generally comprised of water-erodible polymers which include, but are not limited to, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethylmethyl cellulose, polyacrylic acid (PAA) which may or may not be partially crosslinked, sodium carboxymethyl cellulose (NaCMC), and polyvinylpyrrolidone (PVP), or combinations thereof. Other mucoadhesive water-erodible polymers may also be used in the present invention. The term “polyacrylic acid” includes both uncrosslinked and partially crosslinked forms, e.g., polycarbophil.
In some embodiments, the mucoadhesive polymeric diffusion environment is a mucoadhesive layer, e.g, a bioerodable mucoadhesive layer. In some embodiments, the devices of the present invention include a bioerodable mucoadhesive layer which comprises a mucoadhesive polymeric diffusion environment.
In some embodiments, the properties of the polymeric diffusion environment are effected by the barrier environment. The barrier environment is disposed such that the flux of medicament is substantially unidirectional. For example, in an exemplary layered device of the present invention, having a layer comprising a medicament dispersed in a polymeric diffusion environment and a co-terminus barrier layer (see, e.g., FIG. 4B), upon application to the mucosa, some medicament may move to and even cross the boundary not limited by the mucosa or barrier layer. In another exemplary layered device of the present invention, a barrier layer does not completely circumscribe the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device (see, e.g., FIG. 4C). A majority of the medicament in both of these cases, however, flows towards the mucosa. In another exemplary layered device of the present invention, having a barrier layer which circumscribes the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device (see, e.g., FIG. 4A), upon application to the mucosa, substantially all of the medicament typically flows towards the mucosa.
The barrier environment can be, e.g., a backing layer. A backing layer can be included as an additional layer disposed adjacent to the mucoadhesive polymeric diffusion environment. The layers can be coterminous, or, e.g., the barrier layer may circumscribe the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device. In one embodiment, the device comprises a backing layer disposed adjacent to the mucoadhesive polymeric diffusion environment. The device of the present invention can also comprise a third layer or coating. A backing layer can be also included in the devices of the present invention as a layer disposed adjacent to a layer which is, in turn, disposed adjacent to the mucoadhesive polymeric diffusion environment (i.e., a three layer device).
In one embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the medicament to the mucosa. In one embodiment, the device of the present invention further comprises at least one additional layer disposed adjacent to the mucoadhesive polymeric diffusion environment. Such layer can include additional medicament or different medicaments, and/or can be present to further reduce the amount of medicament (originally in the mucoadhesive polymeric diffusion environment) that is washed away in the saliva.
Specialty polymers and non-polymeric materials may also optionally be employed to impart lubrication, additional dissolution protection, drug delivery rate control, and other desired characteristics to the device. These third layer or coating materials can also include a component that acts to adjust the kinetics of the erodability of the device.
The backing layer is a non-adhesive water-erodible layer that may include at least one water-erodible, film-forming polymer. In some embodiments, the backing layer will at least partially or substantially erode or dissolve before the substantial erosion of the mucoadhesive polymeric diffusion environment.
The barrier environment and/or backing layer can be employed in various embodiments to promote unidirectional delivery of the medicament (e.g., fentanyl) to the mucosa and/or to protect the mucoadhesive polymeric diffusion environment against significant erosion prior to delivery of the active to the mucosa. In some embodiments, dissolution or erosion of the water-erodible non-adhesive backing layer primarily controls the residence time of the device of the present invention after application to the mucosa. In some embodiments, dissolution or erosion of the barrier environment and/or backing layer primarily controls the directionality of medicament flow from the device of the present invention after application to the mucosa.
The barrier environment and/or backing layer (e.g., a water-erodible non-adhesive backing layer) can further include at least one water erodible, film-forming polymer. The polymer or polymers can include polyethers and polyalcohols as well as hydrogen bonding cellulosic polymers having either hydroxyalkyl group substitution or hydroxyalkyl group and alkyl group substitution preferably with a moderate to high ratio of hydroxyalkyl to alkyl group. Examples include, but are not limited to, hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropylmethyl cellulose (HPMC), hydroxyethylmethyl cellulose (HEMC), polyvinyl alcohol (PVA), polyethylene glycol (PEG), polyethylene oxide (PEO), ethylene oxide-propylene oxide co polymers, and combinations thereof. The water-erodible non-adhesive backing layer component can optionally be crosslinked. In one embodiment, the water erodible non-adhesive backing layer includes hydroxyethyl cellulose and hydroxypropyl cellulose. The water-erodible non-adhesive backing layer can function as a slippery surface, to avoid sticking to mucous membrane surfaces.
In some embodiments, the barrier environment and/or backing layer, e.g., a bioerodible non-adhesive backing layer, is generally comprised of water-erodible, film-forming pharmaceutically acceptable polymers which include, but are not limited to, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethylmethyl cellulose, polyvinylalcohol, polyethylene glycol, polyethylene oxide, ethylene oxide-propylene oxide co-polymers, or combinations thereof. The backing layer may comprise other water-erodible, film-forming polymers.
The devices of the present invention can include ingredients that are employed to, at least in part, provide a desired residence time. In some embodiments, this is a result of the selection of the appropriate backing layer formulation, providing a slower rate of erosion of the backing layer. Thus, the non-adhesive backing layer is further modified to render controlled erodibility which can be accomplished by coating the backing layer film with a more hydrophobic polymer selected from a group of FDA approved Eudragit™ polymers, ethyl cellulose, cellulose acetate phthalate, and hydroxyl propyl methyl cellulose phthalate, that are approved for use in other pharmaceutical dosage forms. Other hydrophobic polymers may be used, alone or in combination with other hydrophobic or hydrophilic polymers, provided that the layer derived from these polymers or combination of polymers erodes in a moist environment. Dissolution characteristics may be adjusted to modify the residence time and the release profile of a drug when included in the backing layer.
In some embodiments, any of the layers in the devices of the present invention may also contain a plasticizing agent, such as propylene glycol, polyethylene glycol, or glycerin in a small amount, 0 to 15% by weight, in order to improve the “flexibility” of this layer in the mouth and to adjust the erosion rate of the device. In addition, humectants such as hyaluronic acid, glycolic acid, and other alpha hydroxyl acids can also be added to improve the “softness” and “feel” of the device. Finally, colors and opacifiers may be added to help distinguish the resulting non-adhesive backing layer from the mucoadhesive polymeric diffusion environment. Some opacifers include titanium dioxide, zinc oxide, zirconium silicate, etc.
Combinations of different polymers or similar polymers with definite molecular weight characteristics can be used in order to achieve preferred film forming capabilities, mechanical properties, and kinetics of dissolution. For example, polylactide, polyglycolide, lactide-glycolide copolymers, poly-e-caprolactone, polyorthoesters, polyanhydrides, ethyl cellulose, vinyl acetate, cellulose, acetate, polyisobutylene, or combinations thereof can be used.
The device can also optionally include a pharmaceutically acceptable dissolution-rate-modifying agent, a pharmaceutically acceptable disintegration aid (e.g., polyethylene glycol, dextran, polycarbophil, carboxymethyl cellulose, or poloxamers), a pharmaceutically acceptable plasticizer, a pharmaceutically acceptable coloring agent (e.g., FD&C Blue #1), a pharmaceutically acceptable opacifier (e.g., titanium dioxide), pharmaceutically acceptable anti-oxidant (e.g., tocopherol acetate), a pharmaceutically acceptable system forming enhancer (e.g., polyvinyl alcohol or polyvinyl pyrrolidone), a pharmaceutically acceptable preservative, flavorants (e.g., saccharin and peppermint), neutralizing agents (e.g., sodium hydroxide), buffering agents (e.g., monobasic, or tribasic sodium phosphate), or combinations thereof. Preferably, these components are individually present at no more than about 1% of the final weight of the device, but the amount may vary depending on the other components of the device.
The device can optionally include one or more plasticizers, to soften, increase the toughness, increase the flexibility, improve the molding properties, and/or otherwise modify the properties of the device. Plasticizers for use in the present invention can include, e.g., those plasticizers having a relatively low volatility such as glycerin, propylene glycol, sorbitol, ethylene glycol, diethylene glycol, triethylene glycol, propylene glycol, polypropylene glycol, dipropylene glycol, butylene glycol, diglycerol, polyethylene glycol (e.g., low molecular weight PEG's), oleyl alcohol, cetyl alcohol, cetostearyl alcohol, and other pharmaceutical-grade alcohols and diols having boiling points above about 100° C. at standard atmospheric pressure. Additional plasticizers include, e.g., polysorbate 80, triethyl titrate, acetyl triethyl titrate, and tributyl titrate. Additional suitable plasticizers include, e.g., diethyl phthalate, butyl phthalyl butyl glycolate, glycerin triacetin, and tributyrin. Additional suitable plasticizers include, e.g., pharmaceutical agent grade hydrocarbons such as mineral oil (e.g., light mineral oil) and petrolatum. Further suitable plasticizers include, e.g., triglycerides such as medium-chain triglyceride, soybean oil, safflower oil, peanut oil, and other pharmaceutical agent grade triglycerides, PEGylated triglycerides such as Labrifil®, Labrasol® and PEG-4 beeswax, lanolin, polyethylene oxide (PEO) and other polyethylene glycols, hydrophobic esters such as ethyl oleate, isopropyl myristate, isopropyl palmitate, cetyl ester wax, glyceryl monolaurate, and glyceryl monostearate.
One or more disintegration aids can optionally be employed to increase the disintegration rate and shorten the residence time of the device of the present invention. Disintegration aids useful in the present invention include, e.g., hydrophilic compounds such as water, methanol, ethanol, or low alkyl alcohols such as isopropyl alcohol, acetone, methyl ethyl acetone, alone or in combination. Specific disintegration aids include those having less volatility such as glycerin, propylene glycol, and polyethylene glycol.
One or more dissolution-rate-modifying agents can optionally be employed to decrease the disintegration rate and lengthen the residence time of the device of the present invention. Dissolution-rate modifying agents useful in the present invention include, e.g., hydrophobic compounds such as heptane, and dichloroethane, polyalkyl esters of di and tricarboxylic acids such as succinic and citric acid esterified with C6 to C20 alcohols, aromatic esters such as benzyl benzoate, triacetin, propylene carbonate and other hydrophobic compounds that have similar properties. These compounds can be used alone or in combination in the device of the invention.
The devices of the present invention can include various forms. For example, the device can be a disc or film. In one embodiment, the device comprises a mucoadhesive disc. In one embodiment of the methods and devices of the present invention, the device is a layered, flexible device. The thickness of the device of the present invention, in its form as a solid film or disc, may vary, depending on the thickness of each of the layers. Typically, the bilayer thickness ranges from about 0.01 mm to about 1 mm, and more specifically, from about 0.05 mm to about 0.5 mm. The thickness of each layer can vary from about 10% to about 90% of the overall thickness of the device, and specifically can vary from about 30% to about 60% of the overall thickness of the device. Thus, the preferred thickness of each layer can vary from about 0.005 mm to about 1.0 mm, and more specifically from about 0.01 mm to about 0.5 mm.
In one embodiment, the mucoadhesive polymeric diffusion environment of the device of the present invention has a thickness of about 0.03 mm to about 0.07 mm. In one embodiment, the mucoadhesive polymeric diffusion environment of the device of the present invention has a thickness of about 0.04 mm to about 0.06 mm. In yet another embodiment, the mucoadhesive polymeric diffusion environment of the present invention has a thickness of about 0.05 mm. The thickness of the mucoadhesive polymeric diffusion environment is designed to be thick enough so that it can be easily manufactured, yet thin enough to allow for maximum permeability of the medicament through the layer, and maximum absorption of the medicament into the mucosal layer.
In one embodiment, the backing layer of the device of the present invention has a thickness of about 0.050 mm to about 0.350 mm. In one embodiment, the backing layer of the device of the present invention has a thickness of about 0.100 mm to about 0.300 mm. In yet another embodiment, the backing layer of the present invention has a thickness of about 0.200 mm. The thickness of the backing layer is designed to be thick enough so that it allows for substantially unidirectional delivery of the medicament (towards the mucosa), yet thin enough to dissolve so that it does not have to be manually removed by the subject.
In these embodiments, there is relatively minimal mouth feel and little discomfort because of the thinness and flexibility of the devices as compared to conventional tablet or lozenge devices. This is especially advantageous for patients who have inflammation of the mucosa and/or who may otherwise not be able to comfortably use conventional devices. The devices of the present invention are small and flexible enough so that they can adhere to a non-inflamed area of the mucosa and still be effective, i.e., the mucosa does not need to be swabbed with the device of the present invention.
In various embodiments, the devices of the present invention can be in any form or shape such as a sheet or disc, circular or square in profile or cross-section, etc., provided the form allows for the delivery of the active to the subject. In some embodiments, the devices of the present invention can be scored, perforated or otherwise marked to delineate certain dosages. For example, a device may be a square sheet, perforated into quarters, where each quarter comprises a 200 μg dose. Accordingly, a subject can use the entire device for an 800 μg dose, or detach any portion thereof for a 200 μg, 400 μg or 600 μg dose.
The devices of the present invention can be adapted for any mucosal administration. In some embodiments of the methods and devices of the present invention, the device is adapted for buccal administration and/or sublingual administration.
Yet another advantage of the devices of the present invention is the ease with which they are administered. With conventional devices, the user must hold the device in place, or rub the device over the mucosa for the duration of administration, which may last from twenty to thirty minutes or more. The devices of the present invention adhere to the mucosal surface in less than about five seconds, and naturally erode in about twenty to thirty minutes, without any need to hold the device in place.
Without wishing to be bound by any particular theory, it is also believed that the devices of the present invention are substantially easier to use than devices of the prior art. When devices of the prior art are used, they are often subject to much variability, e.g., due to variation in mouth size, diligence of the subject in correctly administering the device and amount of saliva produced in the subject's mouth. Accordingly, in some embodiments, the present invention provides a variable-free method for treating pain in a subject. The term “variable-free” as used herein, refers to the fact that the devices of the present invention provide substantially similar pharmacokinetic profile in all subjects, regardless of mouth size and saliva production.
Without wishing to be bound by any particular theory, it is also believed that the presence of a backing layer also imparts a resistance to the devices of the present invention. Accordingly, in some embodiments, the devices of the present invention are resistant to the consumption of food or beverage. That is, the consumption of food or beverage while using the devices of the present invention does not substantially interfere with the effectiveness of the device. In some embodiments, the performance of the devices of the present invention, e.g., peak fentanyl concentrations and/or overall exposure to the medicament is unaffected by the consumption of foods and/or hot beverages.
In various embodiments, the devices can have any combination of the layers, ingredients or compositions described herein including but not limited to those described above.
EXEMPLIFICATION
Example 1
Preparation of Devices in Accordance with the Present Invention
Transmucosal devices were configured in the form of a disc, rectangular in shape with round corners, pink on one side and white on the other side. The drug is present in the pink layer, which is the mucoadhesive polymeric diffusion environment, and this side is to be placed in contact with the buccal mucosa (inside the cheek). The drug is delivered into the mucosa as the disc erodes in the mouth. The white side is the non-adhesive, backing layer which provides a controlled erosion of the disc, and minimizes the oral uptake of the drug induced by constant swallowing, thus minimizing or preventing first pass metabolism. The mucoadhesive polymeric diffusion environment and backing layer are bonded together and do not delaminate during or after application.
The backing layer was prepared by adding water (about 77% total formulation, by weight) to a mixing vessel followed by sequential addition of sodium benzoate (about 0.1% total formulation, by weight), methylparaben (about 0.1% total formulation, by weight) and propylparaben (about 0.03% total formulation, by weight), citric acid (about 0.1% total formulation, by weight) and vitamin E acetate (about 0.01% total formulation, by weight), and sodium saccharin (about 0.1% total formulation, by weight). Subsequently, a mixture of the polymers hydroxypropyl cellulose (Klucel EF, about 14% total formulation, by weight) and hydroxyethyl cellulose (Natrosol 250L, about 7% total formulation, by weight) was added and stirred at a temperature between about 120 and 130° F., until evenly dispersed. Upon cooling to room temperature, titanium dioxide (about 0.6% total formulation, by weight) and peppermint oil (about 0.2% total formulation, by weight) were then added to the vessel and stirred. The prepared mixture was stored in an air-sealed vessel until it was ready for use in the coating operation.
The mucoadhesive polymeric diffusion environment was prepared by adding water (about 89% total formulation, by weight) to a mixing vessel followed by sequential addition of propylene glycol (about 0.5% total formulation, by weight), sodium benzoate (about 0.06% total formulation, by weight), methylparaben (about 0.1% total formulation, by weight) and propylparaben (about 0.03% total formulation, by weight), vitamin E acetate (about 0.01% total formulation, by weight) and citric acid (about 0.06% total formulation, by weight), red iron oxide (about 0.01% total formulation, by weight), and monobasic sodium phosphate (about 0.04% total formulation, by weight). After the components were dissolved, 800 μg fentanyl citrate (about 0.9% total formulation, by weight) was added, and the vessel was heated to 120 to 130° F. After dissolution, the polymer mixture [hydroxypropyl cellulose (Klucel EF, about 0.6% total formulation, by weight), hydroxyethyl cellulose (Natrosol 250L, about 1.9% total formulation, by weight), polycarbophil (Noveon AA1 (about 0.6% total formulation, by weight), and carboxy methyl cellulose (Aqualon 7LF, about 5.124% total formulation, by weight)] was added to the vessel, and stirred until dispersed. Subsequently, heat was removed from the mixing vessel. As the last addition step, tribasic sodium phosphate and sodium hydroxide were added to adjust the blend to a desired pH. For example, about 0.6% total formulation, by weight of sodium hydroxide and about 0.4% total formulation, by weight of tribasic sodium phosphate can be added to the formulation. Batches were made having pHs of about 6, 7.25, and 8.5. The blend was mixed under vacuum for a few hours. Each prepared mixture was stored in an air-sealed vessel until its use in the coating operation.
The layers were cast in series onto a St. Gobain polyester liner. First, the backing layer was cast using a knife-on-a-blade coating method. The backing layer was then cured in a continuous oven at about 65 to 95° C. and dried. After two coating and drying iterations, an approximately 8 mil (203 to 213 micrometers) thick backing layer is obtained. Subsequently, the mucoadhesive polymeric diffusion environment was cast onto the backing layer, cured in an oven at about 65 to 95° C. and dried. The devices were then die-cut by kiss-cut method and removed from the casting surface.
Example 2
Study of Fentanyl Citrate Uptake in Humans for Delivery Devices of the Present Invention and a Commercially Available Delivery Device
The effect of system pH on the uptake of fentanyl citrate in three exemplary delivery devices of the present invention was evaluated, and compared to that observed in Actiq® Oral Transmucosal Fentanyl Citrate product (Cephalon, Inc., Salt Lake City, Utah), referred to herein as “OTFC”. A randomized, open-label, single-dose, four-period, Latin-square crossover study was conducted in 12 healthy volunteers. An Ethical Review Board approved the study and all subjects gave informed consent before participating. Bioanalytical work using a validated liquid chromatography/mass spectrometry/mass spectrometry (LC/MS/MS) method was performed by CEDRA Clinical Research, LLC (Austin, Tex.).
Twelve (9 male, 3 female) healthy volunteers ranging in age from 21 to 44 years were recruited for the instant study. Subjects tested were free from any significant clinical abnormalities on the basis of medical history and physical examination, electrocardiogram, and screening laboratories. Subjects weighed between about 50 kg and 100 kg and were within 15% of their ideal body weight based on Metropolitan Life tables for height and weight. Subjects were instructed to not consume alcohol, caffeine, xanthine, or foods/beverages containing grapefruit for 48 hours prior to the first dose of study medication and for the entire duration of the study. Subjects were also instructed not to use tobacco or nicotine containing products for at least 30 days prior to the first dose of medication. No subject had participated in any investigational drug study for at least 30 days prior to the instant study; had any significant medical condition either at the time of the study or in the past (including glaucoma and seizure disorders); had a positive drug screen; had used any concomitant medication other than oral contraceptives or acetaminophen for at least 72 hours prior to the first dose; or had a history of allergic reaction or intolerance to narcotics. Premenopausal women not using contraception or having a positive urine beta HCG test were excluded. Table 2, below, shows the demographics of the subjects included in this study.
TABLE 2
Subject Demographics (N = 12)
Age, years
Mean (standard deviation)
32 (7)
Median
31
Range
21-44
Gender, n (%)
Female
3 (25)
Male
9 (75)
Race, n (%)
Black
3 (25)
Caucasian
4 (33)
Hispanic
5 (42)
Height (cm)
Mean (standard deviation)
171.6 (9.3)
Median
172.0
Range
155.0-183.5
Weight (kg)
Mean (standard deviation)
70.5 (9.0)
Median
70.7
Range
52.0-86.5
The study consisted of a screening visit and a 9-day inpatient period during which each subject received single buccal transmucosal doses of each of the four study treatments with 48 hours separating the doses. The four study treatments, each including 800 μg of fentanyl citrate, were: the OTFC and devices prepared as described in Example 1 and buffered at a pH of about 6 (“device at pH 6”), a pH of about 7.25 (“device at pH 7.25”), and a pH of about 8.5 (“device at pH 8.5”).
Subject eligibility was determined at the screening visit, up to 21 days prior to entering the study facility. Subjects arrived at the study facility at 6:00 PM the day prior to dosing (day 0). Predose procedures (physical examination, clinical laboratory tests, electrocardiogram, and substance abuse screen) were performed. After an overnight fast of at least 8 hours, subjects received an oral dose of naltrexone at 6 AM. A standard light breakfast was served approximately 1 hour prior to study drug dosing. A venous catheter was placed in a large forearm or hand vein for blood sampling, and a pulse oximeter and noninvasive blood pressure cuff were attached. Subjects were placed in a semi-recumbent position, which they maintained for 8 hours after each dose.
Subjects received the first dose of drug at 8 AM on day 1 and subsequent doses at the same time on days 3, 5, and 7. Blood samples (7 mL) were collected in ethylenediaminetetraacetic acid (EDTA) for measurement of plasma fentanyl just prior to dose 1 and 5, 7.5, 10, 15, 20, 25, 30, 45, and 60 minutes, and 2, 3, 4, 8, 12, 16, 20, 24, and 48 hours after each dose. The 48-hour post dose sample was collected just prior to administration of the subsequent dose. A total of 511 mL of blood was collected over the study period for pharmacokinetic analysis. Samples were centrifuged and the plasma portion drawn off and frozen at −20° C. or colder.
Finger pulse oximetry was monitored continuously for 8 hours after each dose and then hourly for an additional four hours. If the subject's oxyhemoglobin saturation persistently decreased to less than 90%, the subject was prompted to inhale deeply several times and was observed for signs of decreased oxyhemoglobin saturation. If the oxyhemoglobin saturation value immediately increased to 90% or above, no further action was taken. If the oxyhemoglobin saturation remained below 90% for more than 1 minute, oxygen was administered to the subject via a nasal cannula. Heart rate, respiratory rate, and blood pressure were measured just prior to the dose, and every 15 minutes for 120 minutes, and at 4, 6, 8, and 12 hours post dose. Throughout the study, subjects were instructed to inform the study personnel of any adverse events.
Each subject received a single buccal dose of each of the 4 study treatments in an open-label, randomized crossover design. The measured pH on the three devices during the manufacturing process in accordance with Example 1 were 5.95 for the device at pH 6.0, 7.44 for the device at pH 7.25, and 8.46 for the device at pH 8.5. After subjects rinsed their mouths with water, the delivery devices of the present invention were applied to the oral mucosa at a location approximately even with the lower teeth. The devices were held in place for 5 seconds until the device was moistened by saliva and adhered to the mucosa membrane. After application, subjects were instructed to avoid rubbing the device with their tongues, as this would accelerate the dissolution of the device.
OTFC doses were administered according to the package insert. After each mouth was rinsed with water, the OTFC unit was placed in the mouth between the cheek and lower gum. The OTFC unit was occasionally moved from one side of the mouth to the other. Subjects were instructed to suck, not chew, the OTFC unit over a 15-minute period. To block the respiratory depressive effects of fentanyl, a 50 mg oral dose of naltrexone was administered to each subject at approximately 12 hours and 0.5 hours prior to each dose of study drug and 12 hours after study drug. Naltrexone has been shown not to interfere with fentanyl pharmacokinetics in opioid naïve subjects. Lor M, et al., Clin Pharmacol Ther; 77: P76 (2005).
At the end of the study, EDTA plasma samples were analyzed for plasma fentanyl concentrations using a validated liquid chromatography with tandem mass spectrophotometry (LC/MS/MS) procedure. Samples were analyzed on a SCIEX API 3000 spectrophotometer using pentadeuterated fentanyl as an internal standard. The method was validated for a range of 0.0250 to 5.00 ng/mL based on the analysis of 0.500 mL of EDTA human plasma. Quantitation was performed using a weighted (1/X2) linear least squares regression analysis generated from calibration standards.
Pharmacokinetic data were analyzed by noncompartmental methods in WinNonlin (Pharsight Corporation). In the pharmacokinetic analysis, concentrations below the limit of quantitation (<0.0250 ng/mL) were treated as zero from time-zero up to the time at which the first quantifiable concentration (Cfirst) was observed. Subsequent to Cfirst, concentrations below this limit were treated as missing. Full precision concentration data were used for all pharmacokinetic and statistical analyses. Cfirst was defined as the first quantifiable concentration above the pre-dose concentration because quantifiable data were observed in the pre-dose samples in some subjects. λz was calculated using unweighted linear regression analysis on at least three log-transformed concentrations visually assessed to be on the linear portion of the terminal slope. The t1/2 was calculated as the ratio of 0.693 to λz. Pharmacokinetic parameters were summarized by treatment using descriptive statistics. Values of tfirst, tmax, Cmax, and AUCinf of the three exemplary devices of the present invention were compared to OTFC using an analysis of variance (ANOVA) model and Tukey's multiple comparison test. Statistical analysis was performed using SAS (SAS Institute Inc.). Table 3, below, presents the fentanyl pharmacokinetics for all 4 treatments after a single dose.
TABLE 3
Pharmacokinetic Parameters of OTFC and Three Formulations of BEMA
Fentanyl Citrate
Device
Device
Device
at pH 6
at pH 7.25
at pH 8.5
Fentanyl
Fentanyl
Fentanyl
OTFC 800 μg
800 μg
800 μg
800 μg
(N = 12)
(N = 12)
(N = 12)
(N = 12)
Mean
Mean
Mean
Mean
Parameter
(SD)
CV %
(SD)
CV %
(SD)
CV %
(SD)
CV %
tfirst (hr)
0.23
78.03
0.13
27.99
0.15
54.18
0.21
55.21
(0.18)
(0.04)
(0.08)
(0.11)
Cfirst
0.07
64.95
0.05
35.25
0.06
41.59
0.06
30.08
(ng/mL)
(0.05)
(0.02)
(0.02)
(0.02)
tmax (hr)
2.28
58.04
2.15
53.23
1.61
64.49
2.21
60.64
(1.32)
(1.14)
(1.04)
(1.34)
Cmax
1.03
24.19
1.40
35.12
1.67
45.07
1.39
29.44
(ng/mL)1
(0.25)
(0.49)
(0.75)
(0.41)
AUClast
9.04
39.01
12.17
35.19
12.98
43.04
11.82
38.37
(hr · ng/mL)
(3.53)
(4.28)
(5.59)
(4.54)
AUC0-24
7.75
32.48
10.43
28.74
11.38
37.78
10.18
31.44
(hr · ng/mL)
(2.52)
(3.00)
(4.30)
(3.20)
AUCinf
10.30
37.29
13.68
33.24
14.44
37.33
13.11
36.40
(hr · ng/mL)
(3.84)
(4.55)
(5.39)
(4.77)
% AUCextrap
12.15
68.40
11.53
59.33
11.72
58.96
10.31
43.49
(8.31)
(6.84)
(6.91)
(4.49)
λz (hr−1)
0.05
37.83
0.05
31.10
0.05
21.18
0.06
26.98
(0.02)
(0.02)
(0.01)
(0.02)
t1/2 (hr)
15.33
44.67
15.12
33.66
14.28
19.23
13.33
31.04
(6.85)
(5.09)
(2.75)
(4.14)
MRT
15.92
38.73
15.73
26.63
14.45
21.61
14.31
31.09
(6.17)
(4.19)
(3.12)
(4.45)
1Mean differences of BEMA fentanyl formulations and OTFC significantly different by ANOVA, p = 0.0304.
Abbreviations used herein are as follows: Cfirst is the first quantifiable drug concentration in plasma determined directly from individual concentration-time data; tfirst is the time to the first quantifiable concentration; Cmax is the maximum drug concentration in plasma determined directly from individual concentration-time data; tmax is the time to reach maximum concentration; λz is the observed elimination rate constant; t1/2 is the observed terminal elimination half-life calculated as ln(2)/λz; AUC0-24 is the area under the concentration-time curve from time zero to 24 hours post-dose; calculated using the linear trapezoidal rule and extrapolated using the elimination rate constant if quantifiable data were not observed through 24 hours; AUClast is the area under the concentration-time curve from time zero to the time of the last quantifiable concentration; calculated using the linear trapezoidal rule; AUCinf is the area under the concentration-time curve from time zero extrapolated to infinity, calculated as AUClast+Clast/λz; AUCextrap (%) is the percentage of AUCinf based on extrapolation; MRT is the mean residence time, calculated as AUMCinf/AUCinf, where AUMCinf is the area under the first moment curve (concentration-time vs. time), calculated using the linear trapezoidal rule form time zero to Tlast (AUMClast) and extrapolated to infinity. It should be noted that, because quantifiable data were observed in the pre-dose samples for some subjects, Cfirst was redefined as the first quantifiable concentration above the pre-dose concentration, which was set to zero in calculating mean fentanyl concentrations.
FIG. 1 illustrates the plasma fentanyl concentration from 0 to 48 hours post-dose for the OTFC dose and the doses provided by the three exemplary devices of the present invention. The device at pH 7.25 provided the highest peak concentrations of fentanyl of the three devices of the present invention used in this study. In general, OTFC provided lower fentanyl concentrations for most time points as compared with the devices of the present invention. The device at pH 6 and the device at pH 8.5 yielded very similar concentration-time profiles, with Cmax values of 1.40 ng/mL and 1.39 ng/mL, respectively. These values are midway between the maximum plasma fentanyl values of 1.03 ng/mL for OTFC and 1.67 ng/mL for the device at pH 7.25. After approximately 6 hours post-dose, the fentanyl concentration-time profiles for the three devices of the present invention were similar. The differences in fentanyl Cmax values were statistically significant when comparing all of the devices of the present invention to OTFC (p=0.0304), and for pairwise comparisons of the device at pH 7.25 to OTFC (p<0.05).
In general, quantifiable fentanyl concentrations were observed earlier after administration of one of the three exemplary devices of the present invention (mean tfirst of 8 to 13 minutes) compared with OTFC (mean tfirst of 14 minutes). The device at pH 7.25 yielded the earliest average tmax (1.61 hours) and highest Cmax (mean 1.67 ng/mL). As shown in FIG. 2, fentanyl absorption from a device at pH 7.25 was more rapid over the first hour post dose than from OTFC, with 30-minute mean plasma concentrations of 0.9 ng/mL for the device at pH 7.25 and 0.5 ng/mL for OTFC.
The delivery devices of the present invention provided overall greater exposure to fentanyl, based on AUC0-24 as compared to OTFC. Fentanyl exposure as measured by AUC0-24 values, were similar across groups treated with one of the devices of the present invention, suggesting that comparable amounts of fentanyl enter the systemic circulation from each of the devices. The device at pH 7.25, however, demonstrated approximately 19% greater maximum plasma fentanyl concentration.
Overall, fentanyl concentrations were observed earlier and increased more rapidly after administration of a device of the present invention compared with OTFC. Mean 30 and 60 minute plasma fentanyl concentrations observed with use of the device at pH 7.25 were 1.8 and 1.7 times higher than with OTFC, respectively. Similarly, the maximum plasma fentanyl concentration was 60% higher using a device of the present invention (mean 1.67 ng/mL) when compared to use of OTFC (mean 1.03 ng/mL). The Cmax for OTFC identified in this study is nearly identical to the 1.1 ng/mL Cmax value reported by Lee and co-workers with both a single 800 mcg lozenge as well as two 400 mcg lozenges. Lee, M., et al., J Pain Symptom Manage 2003; 26:743-747. Overall, fentanyl exposure for the fentanyl formulations of the present invention were greater than for OTFC. Mean estimates of AUClast and AUCinf were slightly larger, but the same general trends were observed. This indicates that the transmucosal uptake is significantly improved in the devices of the present invention as compared to OTFC.
Mean t1/2 values and MRT values were similar for all treatment groups and the values in both cases followed the same trend. Additionally, because MRT after extravascular administration is dependent on the absorption and elimination rates, the MRT values suggest that fentanyl absorbs faster from a delivery device of the present invention, particularly with the device at pH 7.25 and the device at pH 8.5. This observation is consistent with the tmax for the delivery devices of the present invention relative to OTFC.
Adverse events were similar across treatment groups and confounded by the co-administration of naltrexone with each study treatment. The most frequent adverse events were sedation and dizziness. One subject experienced oral mucosal irritation with OTFC. No subject experienced mucosal irritation with any of the three exemplary devices of the present invention. All reported adverse events were mild or moderate in nature.
As demonstrated above, the delivery devices of the present invention provide significantly higher plasma fentanyl concentrations than OTFC. The delivery device at pH 7.25 appeared to provide enhanced uptake believed to be attributable to a favorable balance between drug solubility and ionization. Similar studies have shown that the delivery devices of the present invention provide an absolute bioavailability of about 70.5% and buccal absorption was about 51% (estimated by subtracting the AUCinf following an oral dose of fentanyl from the AUCinf following BEMA fentanyl applied to the buccal mucosa, dividing by the single disc BEMA Fentanyl AUCinf, and multiplying by 100).
Example 3
Preparation of Devices in Accordance with the Present Invention
Devices containing buprenorphine were also produced using the same method as described in Example 1, except that buprenorphine was added to the mucoadhesive polymeric diffusion environment, rather than fentanyl citrate.
Example 4
Study of Buprenorphine Uptake in Humans for Delivery Devices of the Present Invention
A study similar to that described in Example 2 was also performed with buprenorphine in exemplary devices of the present invention (at pH 6 and 7.25), suboxone sublingual and buprenex intramuscular. Results from this study are summarized in the graph in FIG. 3. As demonstrated in Table 4, the delivery devices of the present invention at pH 6 appeared to provide enhanced uptake believed to be attributable to a favorable balance between drug solubility and ionization.
TABLE 4
Pharmacokinetic data for buprenorphine
pH
6
7.25
tfirst (hr)
0.75
0.75
Cfirst (ng/mL)
0.0521
0.0845
tmax (hr)
3
3
Cmax (ng/mL)1
1.05
0.86
EQUIVALENTS
Numerous modifications and alternative embodiments of the present invention will be apparent to those skilled in the art in view of the foregoing description. Accordingly, this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the best mode for carrying out the present invention. Details of the structure may vary substantially without departing from the spirit of the invention, and exclusive use of all modifications that come within the scope of the appended claims is reserved. It is intended that the present invention be limited only to the extent required by the appended claims and the applicable rules of law.
All literature and similar material cited in this application, including, patents, patent applications, articles, books, treatises, dissertations and web pages, regardless of the format of such literature and similar materials, are expressly incorporated by reference in their entirety. In the event that one or more of the incorporated literature and similar materials differs from or contradicts this application, including defined terms, term usage, described techniques, or the like, this application controls.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described in any way.
While the present inventions have been described in conjunction with various embodiments and examples, it is not intended that the present teachings be limited to such embodiments or examples. On the contrary, the present inventions encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
The claims should not be read as limited to the described order or elements unless stated to that effect. It should be understood that various changes in form and detail may be made without departing from the scope of the appended claims. Therefore, all embodiments that come within the scope and spirit of the following claims and equivalents thereto are claimed.
|
15198961
|
biodelivery sciences international, inc.
|
USA
|
B2
|
Utility Patent Grant (with pre-grant publication) issued on or after January 2, 2001.
|
Open
|
|
|
Mar 30th, 2022 06:04PM
|
Mar 30th, 2022 06:04PM
|
BioDelivery Sciences
|
|
Pharmaceuticals & Biotechnology
|
|
nasdaq:bdsi
|
BioDelivery Sciences
|
Apr 22nd, 2014 12:00AM
|
Aug 20th, 2012 12:00AM
|
https://www.uspto.gov?id=US08703177-20140422
|
Abuse-resistant mucoadhesive devices for delivery of buprenorphine
|
The present invention provides abuse deterrent mucoadhesive devices for delivery of buprenorphine. Each device comprises a mucoadhesive layer and a backing layer, and the pH in each layer is selected, such that absorption of buprenorphine is maximized.
|
8703177
|
1. An abuse deterrent mucoadhesive device for use in managing pain or opioid dependence, the device comprising:
a mucoadhesive layer comprising between about 0.075 and about 12 mg of buprenorphine buffered to a pH of between about 4.0 and about 6.0; and
a backing layer comprising between about 0.0125 and about 2 mg of naloxone buffered to a pH between about 4.0 and about 4.8,
wherein the pH of the mucoadhesive layer and the pH of the backing layer are different,
wherein the mucoadhesive layer and the backing layer comprise different combinations of polymers but each layer comprises at least one water-erodible polymer selected from the group consisting of: cellulosic polymers, olefinic polymers, polyethers and polyalcohols, and
wherein following transmucosal administration excessive exposure to buprenorphine is avoided while the abuse-deterrent effect of naloxone is retained.
2. The device according to claim 1, wherein the w/w ratio of buprenorphine to naloxone present in the device is between 1:1 and 10:1.
3. The device according to claim 2, wherein the w/w ratio of buprenorphine to naloxone present in the device is 6:1.
4. The device according to claim 3, wherein the mucoadhesive layer is buffered to a pH of between about 4.50 and about 5.50 and the wherein the backing layer is buffered to a pH of between about 4.10 and about 4.4.
5. The device according to claim 4, wherein the mucoadhesive layer is buffered to a pH of about 4.75 and the backing layer is buffered to a pH of about 4.25.
6. The device according to claim 1 wherein the bioavailability of buprenorphine absorbed from the device is greater than 40%.
7. The device according to claim 1, wherein the at least one water-erodible polymer is selected from the group consisting of: polyacrylic acid (PAA), sodium carboxymethyl cellulose (NaCMC), hydroxypropylmethyl cellulose (HPMC), polyvinylpyrrolidone (PVP), hydroxyethylmethyl cellulose (HEMC), hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), polyvinyl alcohol (PVA), polyethylene glycol (PEG), polyethylene oxide (PEO), and ethylene oxide-propylene oxide co-polymers.
|
7
|
RELATED APPLICATIONS
This application claims priority to U.S. Provisional Application No. 61/525,094, filed on Aug. 18, 2011. This application is also related to U.S. patent application Ser. No. 08/734,519, filed on Oct. 18, 1996, now U.S. Pat. No. 5,800,832, issued on Sep. 1, 1998; U.S. patent application Ser. No. 11/639,408, filed on Dec. 13, 2006; U.S. patent application Ser. No. 11/817,915, filed on Sep. 6, 2007; and U.S. patent application Ser. No. 13/184,306, filed on Jul. 15, 2011, now U.S. Pat. No. 8,147,866, issued on Apr. 3, 2012. The entire contents of each of the foregoing applications are incorporated herein by reference.
BACKGROUND
Buprenorphine is a partial μ-opiate receptor agonist, an ORL1/nociceptin receptor agonist with high affinity, and slow association and dissociation from the receptors, and a κ-opiate receptor antagonist. Transmucosal bioavailability of buprenorphine is greater than its oral bioavailability, and, as a result, buprenorphine has been initially developed and marketed as a sublingual dosage form. Buprenorphine has been generally available as Temgesic® 0.2 mg sublingual tablets and as Buprenex® in a 0.3 mg/ml parenteral formulation, both indicated for the treatment of moderate to severe pain.
Because there is some risk of abuse with buprenorphine, particularly in the doses used for opioid dependence, a combination product with naloxone, an opioid antagonist, has been developed. The addition of naloxone to buprenorphine decreases the parenteral abuse potential of buprenorphine in opioid dependent subjects, as injected naloxone precipitates withdrawal by displacing the non-buprenorphine opioid from the receptor sites and blocking those sites from buprenorphine occupancy. Human laboratory studies have been conducted to test different dosage ratios of buprenorphine and naloxone (Fudala P. J. et al., Effects of buprenorphine and naloxone in morphine-stabilized opioid addicts, (1998) Drug Alcohol Depend., 50(1):1-8; Mendelson J. et al., Buprenorphine and naloxone combinations: the effects of three dose ratios in morphine-stabilized, opiate-dependent volunteers, (1999) Psychopharmacology 141:37-46) and have led to the conclusion that a formulation comprising buprenorphine and naloxone at the dose ratio of w/w 2:1 or 4:1 should be optimal for providing deterrence for opiate abusers. Suboxone® a sublingual pill preparation of buprenorphine that contains buprenorphine and naloxone at a 4:1 w/w dose ratio, and has been approved by the FDA for treating opioid dependence.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic representation of exemplary embodiments of the present invention.
FIG. 2 is a graph showing assessment of dose-proportionality of buprenorphine Cmax after administration of the devices of the invention containing 0.875/0.15 mg, 3.5/0.6 mg and 5.25/0.9 mg of buprenorphine/naloxone as described in Example 4.
FIG. 3 is a graph showing assessment of dose-proportionality of buprenorphine AUCinf after administration of the devices of the invention containing 0.875/0.15 mg, 3.5/0.6 mg and 5.25/0.9 mg of buprenorphine/naloxone as described in Example 4.
FIG. 4 is a graph showing COWS total scores recorded within 1 hour of subjects receiving study medication as a part of Naloxone Withdrawal Study as described in Example 5.
FIG. 5 is a graph showing changes in blood pressure, heart rate and oxygen saturation in subjects receiving study medication as a part of Naloxone Withdrawal Study as described in Example 5.
SUMMARY OF THE INVENTION
The present invention is based, at least in part, on the discovery that bioavailability of an opioid agonist, e.g., buprenorphine, disposed in the mucoadhesive layer of a two-layered, abuse-resistant transmucosal drug delivery device is not only affected by the pH of the mucoadhesive layer, but is also affected by the pH of the backing layer that resides on the lingual side of the bi-layer film. This layer may or may not contain an opioid antagonist, however in the preferred embodiment of the composition of the backing layer, it does include an opioid antagonist such as naloxone. Accordingly, both the pH of the mucoadhesive layer and the pH of the backing layer may be chosen such that the absorption of buprenorphine from the mucoadhesive layer is similar or higher than absorption from the mucoadhesive layer of a device with an unbuffered backing layer, while the absorption of naloxone, if present in the backing layer, is impeded.
The present invention is also based, at least in part, on the surprising discovery, that the mucoadhesive devices with buffered backing layer may comprise smaller doses of naloxone, while still providing abuse deterrence. The dose of naloxone is lowered, such that the w/w buprenorphine to naloxone ratio is higher than the ratio of 4:1, accepted in the art as being effective for providing abuse deterrence. In some embodiments, the w/w buprenorphine to naloxone ratio present in the mucoadhesive device of the invention is between 4:1 and 10:1. In a specific embodiment, the w/w buprenorphine to naloxone ratio is 6:1. Such a device is advantageous because it can provide effective abuse deterrence at a lower naloxone dose.
This invention does not purport the need for naloxone in the backing layer. In some embodiments, the amount of naloxone required to precipitate withdrawal is as low as 0.1 mg when abused by injection. In some embodiments, the maximum ratio of buprenorphine dose to naloxone is 10:1 and can be as low at 1:1. In some embodiments, the ratio of buprenorphine dose to naloxone is 10:1 to 4:1. In a specific embodiment, the ratio is 6:1.
In some embodiments, the present invention provides an abuse deterrent mucoadhesive device for use in managing pain or opioid dependence, the device comprising:
a mucoadhesive layer comprising buprenorphine buffered to a pH of between about 4.0 and about 6.0; and
a backing layer buffered to a pH between about 4.0 and about 4.8.
In some embodiments, the absorption of buprenorphine through the oral mucosal membrane is optimized and a therapeutically effective dose of buprenorphine is provided. In some embodiments, the backing layer comprises naloxone. In some embodiments, the w/w ratio of buprenorphine to naloxone present in the device is between 1:1 and 10:1. In some embodiments, the ratio is between about 4:1 and 10:1. In a preferred embodiment, the w/w ratio of buprenorphine to naloxone present in the device is 6:1.
In some embodiments, the present invention provides an abuse deterrent mucoadhesive device for use in managing pain or opioid dependence, the device comprising:
a mucoadhesive layer comprising buprenorphine buffered to a pH of between about 4.0 and about 6.0;
and a backing layer buffered to a pH between about 4.0 and about 4.8;
wherein bioavailability of buprenorphine absorbed from the device is greater than 40%. In some embodiments, the bioavailability is about 60%. In some embodiments, the bioavailability is about 65%. In some embodiments, the bioavailability is about 75%.
In some embodiments, the mucoadhesive layer is buffered to a pH of between about 4.50 and about 5.50 and the backing layer is buffered to a pH of between about 4.10 and about 4.4. In a preferred embodiment, the mucoadhesive layer is buffered to a pH of about 4.75 and the backing layer is buffered to a pH of about 4.25.
In some embodiments, the device comprises about 0.075-12 mg of buprenorphine. In some embodiments, the amount of buprenorphine is 0.15-12 mg of buprenorphine. In some embodiments, the device also comprises about 0.0125-2 mg of naloxone. In some embodiments, the amount of naloxone is about 0.1-2 mg. In some embodiments, the bioavailability of buprenorphine absorbed from the device is greater than 40%.
In some embodiments, the present invention provides an abuse deterrent mucoadhesive device for use in managing pain or opioid dependence, the device comprising:
a mucoadhesive layer comprising buprenorphine and buffered to a first pH;
a backing layer buffered to a second pH;
the second pH selected such that the transmucosal delivery of buprenorphine is not impeded, such that the bioavailability of buprenophine is greater than 40%. In some embodiments, the backing layer comprises naloxone, and the delivery of naloxone is impeded.
In some embodiments, the invention also provides an abuse deterrent mucoadhesive device for use in managing pain or opioid dependence, the device comprising:
a mucoadhesive layer comprising buprenorphine and buffered to a first pH,
a backing layer buffered to a second pH,
the first pH and the second pH selected such that the unidirectional delivery gradient of buprenorphine toward the mucosa is not impeded, such that the total bioavailability of buprenophine provided by the device is similar to the total bioavailability of buprenorphine provided by the same device wherein the pH of the backing layer is not adjusted. In one embodiment, the backing layer comprises naloxone, and the delivery of naloxone is impeded.
In some embodiments, an abuse deterrent mucoadhesive device for use in managing pain or opioid dependence comprises:
a mucoadhesive layer comprising buprenorphine and buffered to a first pH and a backing layer buffered to a second pH;
wherein the first pH is between about 4.0 and about 6.0;
wherein the second pH is between about 4.0 and about 4.8.
In some embodiments, the backing layer comprises naloxone. In some embodiments, buprenorphine and naloxone disposed in the device are present in w/w ratio of about 4:1 to about 10:1 of buprenorphine:naloxone. In one embodiment, the ratio is about 6:1.
In some embodiments, the first pH is between about 4.50 and about 5.50 and the second pH is between about 4.10 and about 4.4. In a specific embodiment, the first pH is about 4.75 and the second pH is about 4.25. In some embodiments, the device comprises about 0.075 to 12 mg of buprenorphine and about 0.0125-2 mg of naloxone.
In some embodiments, an abuse deterrent mucoadhesive device for use in managing pain or opioid dependence comprises:
a mucoadhesive layer comprising buprenorphine and buffered to a first pH and a backing layer buffered to a second pH;
wherein the first pH is between about 4.0 and about 6.0;
wherein the second pH is between about 4.0 and about 4.8; and
wherein bioavailability of buprenorphine absorbed from the device is greater than 40%. In some embodiments, the backing layer comprises naloxone.
In some embodiments, the first pH is between about 4.50 and about 5.50 and the second pH is between about 4.10 and about 4.4. In a specific embodiment, the first pH is about 4.75 and the second pH is about 4.25. In some embodiments, the device comprises about 0.075 to 12 mg of buprenorphine and about 0.0125-2 mg of naloxone.
In a preferred embodiment, the abuse deterrent mucoadhesive device for use in managing pain or opioid dependence comprises:
a mucoadhesive layer comprising buprenorphine and buffered to a first pH and a backing layer comprising naloxone and buffered to a second pH;
wherein the first pH is about 4.75;
wherein the second pH is about 4.25; and
wherein buprenorphine and naloxone disposed in the device are present in w/w ratio of about 6:1 of buprenorphine:naloxone.
In some embodiments, methods of treating pain or managing opioid dependence in a subject are also provided. The methods generally comprise administering to a subject in need thereof an abuse deterrent mucoadhesive device of the invention, such that pain is treated or opioid dependence is managed in a subject.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
The following definitions are provided as guidance as to the meaning of certain terms used herein.
As used herein, the articles “a” and “an” mean “one or more” or “at least one,” unless otherwise indicated. That is, reference to any element of the present invention by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present.
As used herein, the term “absorption” refers to the process of a substance, such as a drug, entering the bloodstream. Absorption can be measured by pharmacokinetic parameters, such as AUCinf and Cmax.
As used herein, the term “acute pain” refers to pain characterized by a short duration, e.g., three to six months. Acute pain is typically associated with tissue damage, and manifests in ways that can be easily described and observed. It can, for example, cause sweating or increased heart rate. Acute pain can also increase over time, and/or occur intermittently.
As used herein, the term “bioavailability” is as defined in 21 CFR Section 320.1 and refers to the rate and extent to which the active ingredient or active moiety is absorbed from a drug product and becomes available at the site of action. The term “bioavailable,” “absolute bioavailability” or “total bioavailability” refers to the total bioavailability including amounts that are transmitted via the mucosal membrane (i.e., transmucosally) and through the GI tract. The term “absolute bioavailability” refers to a fraction of a drug absorbed through non-intravenous administration (i.e., transmucosal, oral, rectal, transdermal, subcutaneous, or sublingual administration) compared with the bioavailability of the same drug following intravenous administration. The comparison is dose normalized, i.e., accounts for different doses consequently, the amount absorbed is corrected by dividing the corresponding dose administered. In some embodiments, the mucoadhesive devices of the present invention provide absolute bioavailability of the opioid agonist buprenorphine that is equal to or greater than 40%, e.g., 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
As used herein, the term “bioequivalence” or “bioequivalent” is as defined in 21 CFR Section 320.1, and means the absence of a significant difference in the rate and extent of absorption of an active ingredient or active moiety in one pharmaceutical product and another. For bioequivalence, the pharmacokinetic parameters Cmax and AUC for bioequivalent actives fall within the 80%-125% range of each other. In some embodiments, the devices of the present invention may be bioequivalent to Suboxone® sublingual tablet. Pharmacokinetic parameters, e.g., Cmax and AUCinf, for Suboxone® sublingual tablets comprising 2.0/0.5 mg and 8.0/2.0 mg of buprenorphine/naloxone is contained in the product label for Suboxone®, which is incorporated herein by reference in its entirety.
As used herein, the term “chronic pain” refers to pain which persists beyond the usual recovery period for an injury or illness. Chronic pain can be constant or intermittent. Common causes of chronic pain include, but are not limited to, arthritis, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), repetitive stress injuries, shingles, headaches, fibromyalgia, and diabetic neuropathy, lower back pain, neck and shoulder pain, moderate to severe osteoarthritis, and patients with severe migraine.
As used herein, unless indicated otherwise, the term “buprenorphine”, includes any pharmaceutically acceptable form of buprenorphine, including, but not limited to, salts, esters, and prodrugs thereof. In one embodiment, the term “buprenorphine” refers to buprenorphine hydrochloride. As used herein, the term “buprenorphine derivative” refers to compounds having similar structure and function to buprenorphine. In some embodiments, buprenorphine derivatives include those of the following formula:
or pharmaceutically acceptable salts or esters thereof, wherein
is a double or single bond; R3 is selected from a —C14 alkyl group or a cycloalkyl-substituted-C1-4 alkyl group; R4 is selected from a —C1-4 alkyl; R5 is —OH, or taken together, R4 and R5 form a ═O group; and R6 is selected from —H or a —C1-4 alkyl group.
Buprenorphine derivatives include, but are not limited to, etorphine and diprenorphine. General buprenorphine derivatives are described in WO 2008/011194, which is hereby incorporated by reference.
As used herein, unless indicated otherwise, the term “naloxone” includes any pharmaceutically acceptable form of naloxone, including, but not limited to, salts, esters, and prodrugs thereof. In one embodiment, the term “naloxone” refers to naloxone hydrochloride. In some embodiments, naloxone is represented by the following chemical structure:
As used herein, the term “mucoadhesive layer” or “polymeric diffusion environment” refers to an environment capable of allowing flux of a medicament to a mucosal surface upon creation of a gradient by adhesion of the polymeric diffusion environment to a mucosal surface. The flux of a transported medicament is proportionally related to the diffusivity of the environment which can be manipulated by, e.g., adjusting the pH, taking into account the ionic nature of the medicament and/or the ionic nature of the polymer or polymers included in the environment.
As used herein, the term “backing layer” or “non-adhesive polymeric environment” refers to an environment in the form of, e.g., a layer or coating or barrier layer, capable of slowing, reducing or stopping flux of a medicament in its direction and does not adhere to surfaces in the oral cavity. In some embodiments, the pH of the backing layer is adjusted, such as it stops flux of a medicament contained therein and in the mucoadhesive layer, except in the direction of the mucosa. In some embodiments, the non-adhesive polymeric environment significantly slows flux of a medicament, e.g., enough so that little or no medicament is washed away by saliva. In some embodiments, the non-adhesive polymeric environment slows or stops flux of a medicament, while allowing hydration of the polymeric diffusion environment e.g., by saliva.
As used herein, the term “unidirectional gradient” refers to a gradient which allows for the flux of a medicament (e.g., buprenorphine) through the device, e.g., through a polymeric diffusion environment, in substantially one direction, e.g., to the mucosa of a subject. For example, the polymeric diffusion environment may be a mucoadhesive polymeric diffusion environment in the form of a layer or film disposed adjacent to a backing layer or film. Upon mucosal administration, a gradient is created between the mucoadhesive polymeric diffusion environment and the mucosa, and the medicament flows from the mucoadhesive polymeric diffusion environment, substantially in one direction towards the mucosa. In some embodiments, some flux of the medicament is not entirely unidirectional across the gradient; however, there is typically not free flux of the medicament in all directions.
As used herein, “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of preventing, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder (e.g., to alleviate pain).
The term “subject” refers to living organisms such as humans, dogs, cats, and other mammals. Administration of the medicaments included in the devices of the present invention can be carried out at dosages and for periods of time effective for treatment of a subject. In some embodiments, the subject is a human. In some embodiments, the pharmacokinetic profiles of the devices of the present invention are similar for male and female subjects.
An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
The term “transmucosal,” as used herein, refers to any route of administration via a mucosal membrane. Examples include, but are not limited to, buccal, sublingual, nasal, vaginal, and rectal. In one embodiment, the administration is buccal. In one embodiment, the administration is sublingual. As used herein, the term “direct transmucosal” refers to mucosal administration via the oral mucosa, e.g., buccal and/or sublingual.
As used herein, the term “water erodable” or “at least partially water erodable” refers to a substance that exhibits a water erodability ranging from negligible to completely water erodable. The substance may readily dissolve in water or may only partially dissolve in water with difficulty over a long period of time. Furthermore, the substance may exhibit a differing erodability in body fluids compared with water because of the more complex nature of body fluids. For example, a substance that is negligibly erodable in water may show an erodability in body fluids that is slight to moderate. However, in other instances, the erodability in water and body fluid may be approximately the same.
The term “impeded” when used to describe the absorption or the delivery of the opioid antagonist from the abuse-resistant device refers to the absorption and/or delivery of said opioid antagonist that is insufficient to inhibit the effects of the opioid agonist comprised in the same device.
As used herein, “addiction therapy” as related to a subject includes the administration of a drug to a subject with the purpose of reducing the cravings for the addictive substance.
As used herein, the term “abusive” or “abusive manner” refers to uses of the devices beyond transmucosal administration such as by injecting or snorting.
As used herein, the term “disposed” refers to the uniform or non-uniform distribution of an element within another.
Maintenance Treatment of Opioid Dependence
Certain aspects of the present invention include methods for providing maintenance treatment for a subject addicted to opioids. Presently, buprenorphine maintenance is one of the most promising courses of action for addicted subjects in terms of long-term abstinence.
Pain Management
Certain aspects of the present invention include methods for providing pain management and/or relief to a subject in need thereof. The pain can be any pain known in the art, caused by any disease, disorder, condition and/or circumstance and can be chronic pain or acute pain.
Transmucosal Mucoadhesive Pharmaceutical Delivery Device
In certain aspects of the present invention, abuse-resistant transmucosal delivery devices are provided. Accordingly, in one embodiment, the present invention is directed to abuse-resistant mucoadhesive delivery devices suitable for administration of an effective amount of an opioid drug to a subject, for the management of pain and/or opioid dependence. The device is capable of delivering the opioid agonist by means of a unidirectional gradient (i.e. flux that flows toward the mucosa) that is created upon application of the device to a mucosal surface.
The devices of the present invention can include any combination or sub-combination of ingredients, layers and/or compositions of, e.g., the devices described in U.S. Pat. Nos. 6,159,498, 5,800,832, 6,585,997, 6,200,604, 6,759,059 and/or PCT Publication No. WO 05/06321. The contents of these patent and publications are incorporated herein by reference in their entireties.
i. Mucoadhesive Layer
In some embodiments, the mucoadhesive layer is a bioerodable or water-erodable mucoadhesive layer. In some embodiments, the devices of the present invention include a bioerodable mucoadhesive layer which comprises a mucoadhesive polymeric diffusion environment. The device adheres to a mucosal surface of the subject within about 5 seconds following application.
In some embodiments, the mucoadhesive polymeric diffusion environment comprises an opioid agonist. In some embodiments, the opioid agonist is buprenorphine. In some embodiments related to the treatment of opioid dependence, the dose of buprenorphine that can be incorporated into the device of the present invention depends on the desired treatment dosage to be administered and can range from about 10 μg to about 20 mg of buprenorphine. In other embodiments related to the treatment of pain, the dose of buprenorphine can range from about 60 μg to about 6 mg. In some embodiments, the low dose of buprenorphine comprised in the mucoadhesive device of the invention is between about 0.075 and 12 mg of buprenorphine, e.g., 0.075 mg, 0.080 mg, 0.085 mg, 0.090 mg, 0.095 mg, 0.10 mg, 0.15 mg, 0.20 mg, 0.25 mg, 0.30 mg, 0.35 mg, 0.40 mg, 0.45 mg, 0.50 mg, 0.44 mg, 0.60 mg, 0.65 mg, 0.70 mg, 0.75 mg, 0.80 mg, 0.85 mg, 0.90 mg, 0.95 mg, 1.00 mg, 1.5 mg, 1.75 mg, 2.0 mg, 2.5 mg, 3.0 mg, 3.5 mg, 4.0 mg, 4.5 mg, 5.0 mg, 5.25 mg, 5.5 mg, 6.0 mg, 6.5 mg, 7.0 mg, 7.5 mg, 8.0 mg, 8.5 mg, 9.0 mg, 9.5 mg, 10.0 mg, 10.5 mg, 11.0 mg, 11.5 mg or 12.0 mg or buprenorphine. In one embodiment, the dose is 0.875 mg of buprenorphine. In another embodiment, the dose is 1.75 mg of buprenorphine. In another embodiment, the dose is 3.5 mg of buprenorphine. In yet another embodiment, the dose is 5.25 mg of buprenorphine.
In some embodiments, the mucoadhesive polymeric diffusion environment can include the drug, at least one pharmacologically acceptable polymer capable of bioadhesion (the “bioadhesive polymer”), and can optionally include at least one film-forming bioerodable or water-erodable polymer (the “film-forming polymer”). Alternatively, the mucoadhesive polymeric diffusion environment can be formed of a single polymer that acts as both the bioadhesive polymer and the first film-forming polymer. Additionally or alternatively, the mucoadhesive polymeric diffusion environment can include other film-forming water-erodable polymers and/or water-erodable plasticizers, such as glycerin and/or polyethylene glycol (PEG).
In some embodiments, the bioadhesive polymer of the mucoadhesive polymeric diffusion environment can include any water erodable substituted cellulosic polymer or substituted olefinic polymer wherein the substituents may be ionic or hydrogen bonding, such as carboxylic acid groups, hydroxyl alkyl groups, amine groups and amide groups. For hydroxyl containing cellulosic polymers, a combination of alkyl and hydroxyalkyl groups will be preferred for provision of the bioadhesive character and the ratio of these two groups will have an effect upon water swellability and dispersability. Examples include polyacrylic acid (PAA), which can optionally be partially cross-linked, sodium carboxymethyl cellulose (NaCMC), moderately to highly substituted hydroxypropylmethyl cellulose (HPMC), polyvinylpyrrolidone (PVP3 which can optionally be partially cross-linked), moderately to highly substituted hydroxyethylmethyl cellulose (HEMC) or combinations thereof. In one embodiment, HEMC can be used as the bioadhesive polymer and the first film forming polymer as described above for a mucoadhesive polymeric diffusion environment formed of one polymer. These bioadhesive polymers are preferred because they have good and instantaneous mucoadhesive properties in a dry, system state.
In some embodiments, the mucoadhesive polymeric diffusion environment, e.g., a bioerodable mucoadhesive layer, is generally comprised of water-erodable polymers which include, but are not limited to, hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropylmethyl cellulose (HPMC), hydroxyethylmethyl cellulose (HEMC), polyacrylic acid (PAA) which may or may not be partially cross-linked, sodium carboxymethyl cellulose (NaCMC), and polyvinylpyrrolidone (PVP), or combinations thereof. Other mucoadhesive water-erodable polymers may also be used in the present invention. The term “polyacrylic acid” includes both uncross-linked and partially cross-linked forms, e.g., polycarbophil.
Similar film-forming water-erodable polymers can also be used. The film-forming water-erodable polymers can optionally be cross-linked and/or plasticized in order to alter its dissolution kinetics.
In some embodiments, the properties of the mucoadhesive polymeric diffusion environment are influenced by its pH. In some embodiments, e.g., when mucoadhesive polymeric diffusion environment comprises buprenorphine, its pH is between about 4.0 and about 7.5. In one embodiment, the pH is between 4.0 and 6.0, more specifically, between 4.5 and 5.5, and even more specifically, between 4.75 and 5.25. In a specific embodiment, the pH is 4.75. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
The pH of the mucoadhesive polymeric diffusion environment can be adjusted and/or maintained by methods including, but not limited to, the use of buffering agents, or by adjusting the composition of the device of the present invention.
Buffering agents suitable for use with the present invention include, for example, phosphates, such as sodium phosphate; phosphates monobasic, such as sodium dihydrogen phosphate and potassium dihydrogen phosphate; phosphates dibasic, such as disodium hydrogen phosphate and dipotassium hydrogen phosphate; phosphates tribasic, such as trisodium phosphate; citrates, such as sodium citrate (anhydrous or dehydrate) and triethyl citrate; bicarbonates, such as sodium bicarbonate and potassium bicarbonate; acetates, such as sodium acetate, may be used. In one embodiment, a single buffering agent, e.g., a dibasic buffering agent is used. In another embodiment, a combination of buffering agents is employed, e.g., a combination of a tri-basic buffering agent and a monobasic buffering agent. In some embodiments, the amount of buffering agent is present in a composition used to make the mucoadhesive layer is about 1 to 20% of the amount of the agonist drug, e.g., buprenorphine.
ii. Backing Layer
The device further comprises at least one additional non-adhesive polymeric environment, e.g., a backing layer. This layer is disposed adjacent to the mucoadhesive polymeric diffusion environment, e.g., a backing layer, functions to facilitate the delivery of the opioid agonist, such as buprenorphine, to the mucosa. This additional layer may comprise the same or a different combination of polymers as the mucoadhesive polymeric diffusion environment or the non-adhesive polymeric diffusion environment.
In some embodiments, the backing layer includes an additional medicament, such as an opioid antagonist, to render the device of the invention abuse-resistant. In some embodiments, the opioid antagonist is naloxone. The dose of naloxone that can be incorporated into the device of the present invention depends on the desired treatment dosage to be administered and can range from about 100 μg to 5 mg of naloxone for the treatment of dependence, and from 60 μg to 1.5 mg naloxone for the pain indication. In some embodiments, the dose of naloxone is between about 0.0125 mg to about 2.0 mg of naloxone, e.g., 0.0125 mg, 0.0130 mg, 0.0135 mg, 0.0140 mg, 0.0145 mg, 0.0150 mg, 0.0155 mg, 0.0160 mg, 0.0165 mg, 0.0170 mg, 0.0175 mg, 0.0180 mg, 0.0185 mg, 0.0190 mg, 0.0195 mg, 0.02 mg, 0.03 mg, 0.04 mg, 0.05 mg, 0.06 mg, 0.07 mg, 0.08 mg, 0.09 mg, 0.1 mg, 0.145 mg, 0.2 mg, 0.29 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.58 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.87 mg, 0.9 mg, 1.0 mg, 1.1 mg, 1.2 mg, 1.3 mg, 1.4 mg, 1.5 mg, 1.6 mg, 1.7 mg, 1.8 mg, 1.9 mg or 2.0 mg of naloxone. In one embodiment, the dose is 0.145 mg of naloxone. In another embodiment, the dose is 290 μg of naloxone. In another embodiment, the dose is 580 μg of naloxone. In yet another embodiment, the dose is 870 μg of naloxone. In some embodiments, the amount of buprenorphine and the amount of naloxone disposed in the device are present in a ratio chosen such that the effect of buprenorphine is negated by naloxone if the mixture is injected or snorted. In such embodiment, buprenorphine and naloxone disposed in the device are present in a w/w ratio that ranges between 1:4 and 1:10. In a preferred embodiment, the w/w ratio of buprenorphine to naloxone is 1:4 to 1:6, wherein 1:6 is the most preferred embodiment.
In some embodiments, the backing layer (i.e., the non-adhesive polymeric embodiment) functions as a barrier to facilitate a unidirectional flux of the medicament, e.g., buprenorphine, disposed in the mucoadhesive layer. Upon application to a mucosal surface, a diffusional gradient of a medicament is created towards the mucosa. In another embodiment the backing layer, can serve an erodible polymer that facilitate absorption of buprenorphine in the orophyrangeal tissue. In some embodiments, prevents diffusion away from the mucosal surface. In such instances, a majority of the medicament, i.e., at least 50% flows towards the mucosa. In other embodiments, as depicted in FIG. 1, the non-adhesive polymeric environment may circumscribe the boundaries of the mucoadhesive polymeric diffusion environment thereby ensuring that medicament flows toward the mucosa.
The backing layer (e.g., a water-erodable non-adhesive backing layer) can further include at least one water erodable, film-forming polymer. This layer may optionally include a drug. The polymer or polymers can include polyethers and polyalcohols as well as hydrogen bonding cellulosic polymers having either hydroxyalkyl group substitution or hydroxyalkyl group and alkyl group substitution preferably with a moderate to high ratio of hydroxyalkyl to alkyl group. Examples include, but are not limited to, hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropylmethyl cellulose (HPMC), hydroxyethylmethyl cellulose (HEMC), polyvinyl alcohol (PVA), polyethylene glycol (PEG), polyethylene oxide (PEO), ethylene oxide-propylene oxide co polymers, ethylene oxide-propylene oxide co-polymers, and combinations thereof. The water-erodable non-adhesive backing layer component can optionally be cross-linked.
In certain embodiments, the non-adhesive backing layer is free of cross-linked polymers. In a preferred embodiment of the device, the non-adhesive backing layer is free of polyacrylic acid. While not wishing to be bound by any specific theory, it is estimated that the residence time is reduced by the absence of said polyacrylic acid. For example, in certain embodiments, the residence time is between 15 and 30 minutes. In a preferred embodiment, the water erodable non-adhesive backing layer includes hydroxyethyl cellulose and hydroxypropyl cellulose.
The devices of the present invention can include ingredients that are employed to, at least in part, provide a desired residence time. In some embodiments, this is a result of the selection of the appropriate backing layer formulation, providing a slower rate of erosion of the backing layer. Thus, the non-adhesive backing layer is further modified to render controlled erodability which can be accomplished by coating the backing layer film with a more hydrophobic polymer selected from a group of FDA approved Eudragit™ polymers, ethyl cellulose, cellulose acetate phthalate, and hydroxyl propyl methyl cellulose phthalate, that are approved for use in other pharmaceutical dosage forms. Other hydrophobic polymers may be used, alone or in combination with other hydrophobic or hydrophilic polymers, provided that the layer derived from these polymers or combination of polymers erodes in a moist environment. Dissolution characteristics may be adjusted to modify the residence time and the release profile of a drug when included in the backing layer.
In some embodiments, any of the layers in the devices of the present invention may also contain a plasticizing agent, such as propylene glycol, polyethylene glycol, or glycerin in a small amount, 0 to 15% by weight, in order to improve the “flexibility” of this layer in the mouth and to adjust the erosion rate of the device. In addition, humectants such as hyaluronic acid, glycolic acid, and other alpha hydroxyl acids can also be added to improve the “softness” and “feel” of the device. Finally, colors and opacifiers may be added to help distinguish the resulting non-adhesive backing layer from the mucoadhesive polymeric diffusion environment. Some opacifers include titanium dioxide, zinc oxide, zirconium silicate, etc.
The device can also optionally include a pharmaceutically acceptable dissolution-rate-modifying agent, a pharmaceutically acceptable disintegration aid (e.g., polyethylene glycol, dextran, polycarbophil, carboxymethyl cellulose, or poloxamers), a pharmaceutically acceptable plasticizer, a pharmaceutically acceptable coloring agent (e.g., FD&C Blue #1), a pharmaceutically acceptable opacifier (e.g., titanium dioxide), pharmaceutically acceptable anti-oxidant (e.g., tocopherol acetate), a pharmaceutically acceptable system forming enhancer (e.g., polyvinyl alcohol or polyvinyl pyrrolidone), a pharmaceutically acceptable preservative, flavorants (e.g., saccharin and peppermint), neutralizing agents (e.g., sodium hydroxide), buffering agents (e.g., monobasic, or tribasic sodium phosphate), or combinations thereof. Preferably, these components are individually present at no more than about 1% of the final weight of the device, but the amount may vary depending on the other components of the device.
In some embodiments, the non-adhesive polymeric diffusion environment, e.g., the backing layer, is a buffered environment. In some embodiments the pH of the backing layer is between 4.0 and 6.0, more specifically, between 4.2 and 4.7, and even more specifically, between 4.2 and 4.4. In one embodiment, the pH of the backing layer is 4.25. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
The pH of the backing layer can be adjusted and/or maintained by methods including, but not limited to, the use of buffering agents, or by adjusting the composition of the device of the present invention. In some embodiments, the properties of the polymeric diffusion environment are influenced by its buffering capacity. In some embodiments, buffering agents are included in the mucoadhesive polymeric diffusion environment. Buffering agents suitable for use with the present invention include, for example, phosphates, such as sodium phosphate; phosphates monobasic, such as sodium dihydrogen phosphate and potassium dihydrogen phosphate; phosphates dibasic, such as disodium hydrogen phosphate and dipotassium hydrogen phosphate; phosphates tribasic, such as trisodium phosphate; citrates, such as sodium citrate (anhydrous or dehydrate) and triethyl citrate; bicarbonates, such as sodium bicarbonate and potassium bicarbonate; acetates, such as sodium acetate, may be used. In one embodiment, a single buffering agent, e.g., a dibasic buffering agent is used. In another embodiment, a combination of buffering agents is employed, e.g., a combination of a tri-basic buffering agent and a monobasic buffering agent. In some embodiments, the backing layer comprises the opioid antagonist. In another embodiment, the backing layer comprises an opioid antagonist that is present as a microencapsulated particle with polymers. These polymers include, but are not limited to alginates, polyethylene oxide, poly ethylene glycols, polylactide, polyglycolide, lactide-glycolide copolymers, poly-epsilon-caprolactone, polyorthoesters, polyanhydrides and derivatives, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxyethylmethyl cellulose, hydroxypropylmethyl cellulose, polyacrylic acid, and sodium carboxymethyl cellulose, poly vinyl acetate, poly vinyl alcohols, polyethylene glycol, polyethylene oxide, ethylene oxide-propylene oxide co-polymers, collagen and derivatives, gelatin, albumin, polyaminoacids and derivatives, polyphosphazenes, polysaccharides and derivatives, chitin, chitosan bioadhesive polymers, polyacrylic acid, polyvinyl pyrrolidone, sodium carboxymethyl cellulose and combinations thereof.
EXEMPLIFICATION OF THE INVENTION
The invention will be further understood by the following examples. However, those skilled in the art will readily appreciate that the specific experimental details are only illustrative and are not meant to limit the invention as described herein, which is defined by the claims which follow thereafter.
Example 1
Preparation of the Devices of the Invention
Several formulations were prepared comprising different doses of buprenorphine and naloxone, with the backing layers adjusted to different pHs, as described in the Table 1 below:
TABLE 1
Formulations of the invention
pH
pH
Ratio of
Formu-
back-
muco-
buprenorphine
lation
ing
adhesive
Buprenorphine
Naloxone
to naloxone
No.
layer
layer
(mg)
(mg)
(w/w)
1
2.8
4.75
0.75
0.1875
4:1
2
2.8
4.75
3.0
0.75
4:1
3
4.25
4.75
0.75
0.1875
4:1
4
4.25
4.75
3.0
0.75
4:1
5
4.25
4.75
0.875
0.15
6:1
6
4.25
4.75
3.5
0.6
6:1
7
4.25
4.75
5.25
0.875
6:1
The ingredients used to prepare the mucoadhesive layer for Formulations 2, 4 and 6 are summarized in the Table 2 below:
TABLE 2
Ingredients for preparing the mucoadhesive layer at pH 4.75
Amount (mg)
Formulation 2
Formulation 4
Formulation 6
Ingredient
3.11 cm2 film
3.11 cm2 film
3.58 cm2 film
Purified Water
Constitutes
Constitutes
Constitutes
88.911% w/w of
88.911% w/w of
88.911% w/w of
the wet blend
the wet blend
the wet blend
Propylene
0.704
0.704
0.822
Glycol
Sodium
0.082
0.082
0.095
Benzoate
Methylparaben
0.137
0.137
0.160
Propylparaben
0.038
0.038
0.045
Yellow Ferric
0.082
0.082
0.095
Oxide
Citric Acid,
0.082
0.082
0.096
Anhydrous
Vitamin E
0.008
0.008
0.010
Acetate
Monobasic
0.521
0.520
0.607
Sodium
Phosphate,
Anhydrous
Buprenorphine
3.234
3.234
3.773
HCl
Polycarbophil
0.980
0.979
1.143
Hydroxypropyl
1.051
1.051
1.226
Cellulose
Hydroxyethyl
3.144
3.143
3.668
Cellulose
Carboxy-
8.399
8.398
9.799
methyl-
cellulose
Sodium
Sodium
0.043
0.043
0.051
Hydroxide
The mucoadhesive layer for Formulations 1 and 3 is prepared using the same ingredients as for formulations 2 and 4, respectively, except that the amounts of all ingredients are adjusted in direct proportion to the amount of buprenorphine and the film size of 0.78 cm2. Similarly, the mucoadhesive layer for Formulations 5 and 7 are prepared using the same ingredients as for Formulation 6, except that the amounts of all ingredients are adjusted in direct proportion to the amount of buprenorphine and film size of 0.9 cm2 for formulation 5 and 5.37 cm2 for Formulation 7.
The ingredients used to prepare the backing layer in Formulation 2 are summarized in the Table 3 below:
TABLE 3
Ingredients for preparing the backing layer at pH 2.8 and 4.25
Amount (mg)
Formulation 2
Formulation 4
Formulation 6
Ingredient
3.11 cm2 film
3.11 cm2 film
3.58 cm2 film
Purified Water
Constitutes
Constitutes
Constitutes
88.911% w/w of
88.911% w/w of
88.911% w/w of
the wet blend
the wet blend
the wet blend
Hydroxypropyl
—
46.337
56.164
Cellulose
Hydroxyethyl
65.182
22.920
27.740
Cellulose
Sodium
0.296
0.371
0.449
Benzoate
Methylparaben
0.296
0.337
0.408
Propylparaben
0.074
0.067
0.082
Dibasic
—
0.167
0.203
Sodium
Phosphate
Citric acid,
2.955
0.412
0.498
anhydrous
Vitamin E
0.030
0.034
0.041
acetate
Saccharin
1.786
1.416
0.054
Sodium
Yellow Ferric
0.057
0.044
1.751
Oxide
Triethyl Citrate
3.774
—
—
Citrus Flavor
—
1.989
2.409
Peppermint Oil
0.608
—
—
Naloxone HCl
0.916
0.916
0.733
The backing layer for Formulations 1 and 3 is prepared using the same ingredients as for Formulations 2 and 4, respectively, except that the amounts of all ingredients are adjusted in direct proportion to the amount of naloxone and the film size of 0.78 cm2. Similarly, the backing layer for Formulations 5 and 7 is prepared using the same ingredients as for Formulation 6, except that the amounts of all ingredients are adjusted in direct proportion to the amount of buprenorphine and film size of 0.9 cm2 for Formulation 5 and 5.37 cm2 for Formulation 7.
Example 2
Absorption Profiles for Formulations 1 and 2
This was an open label, active controlled study in healthy subjects in order to compare pharmacokinetic parameters of buprenorphine and naxolone from formulations 1 and 2 with Suboxone® sublingual tablets. Blood samples for analysis were collected pre-dose and at 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12 and 16 hours post-dose and analyzed using the established procedures utilizing liquid chromatography and mass spectrometry (LC/MS). These selected pharmacokinetic parameters for buprenorphine and total naloxone are shown in Table 4.
TABLE 4
Selected Pharmacokinetic Parameters for Buprenorphine
and Total Naloxone for low dose formulations.
Formulation 1 (0.75 mg
Suboxone ® (2.0 mg
buprenorphine/0.1875 mg naloxone,
buprenorphine/0.5 mg
backing layer at pH 2.8)
naloxone)
Pharmacokinetic
Total
Total
Parameter
Buprenorphine
Naloxone
Buprenorphine
Naloxone
Mean Tmax (hr)
2.29
1.29
1.75
0.92
Mean Cmax (ng/mL)
0.564
2.24
1.28
5.88
Mean AUClast (hr * ng/mL)
3.379
4.021
9.177
12.38
Mean AUCinf (hr * ng/mL)
3.868
4.585
10.92
13.26
Mean T1/2
10.72
2.58
23.72
4.15
Absolute Bioavailability
46%
—
25% 1
—
1 Roy, S. D. et al., Transdermal delivery of buprenorphine through cadaver skin (1994), J. Pharm. Sci., 83: 126-130.
The results indicate that Cmax and AUCinf values for buprenorphine and total naloxone from Formulation 1 are less than the values observed from the control Suboxone® tablet.
Example 3
Absorption Profiles for Formulations 3 and 4
This study was designed to compare the plasma pharmacokinetic parameters of buprenorphine and naxolone from formulations 3 and 4 with Suboxone® sublingual tablets. This was a single dose, 2-period, crossover design with 24 subjects randomized to one of two, 12-subject groups. Each group received the device of the invention and Suboxone® tablets in random sequence, each separated by at least 5 days. Group 1 subjects received a single low dose Suboxone® tablet (containing 2.0 mg of buprenorphine and 0.5 mg of naloxone) and a single dose of formulation 3. Group 2 subjects received a single high dose Suboxone® tablet (containing 8.0 mg of buprenorphine and 2.0 mg of naloxone) and a single dose of formulation 4. Naltrexone was co-administered approximately 12 hours and 30 minutes prior to and approximately 12 and 24 hours after the single study drug doses. Serial blood samples for pharmacokinetic analyses were collected pre-dose and 15, 30, 45, 60, 75, 90, 105, 120, 135, 150, 165, 180, 210, 240, 270, 300, 330 and 360 minutes post-dose and at 8, 10, 12, 24 and 48 hours post-dose. Blood samples were analyzed using the established procedures utilizing liquid chromatography and mass spectrometry (LC/MS). The selected pharmacokinetic parameters for buprenorphine and free naloxone are shown in Tables 6 and 7.
TABLE 6
Selected Pharmacokinetic Parameters for Buprenorphine
and Free Naloxone for low dose formulations
Formulation 3 (0.75 mg
Suboxone ® (2.0 mg
buprenorphine/0.1875 mg naloxone,
buprenorphine/0.5 mg
backing layer at pH 4.25)
naloxone)
Pharmacokinetic
Free
Free
Parameter
Buprenorphine
Naloxone
Buprenorphine
Naloxone
Mean Tmax (hr)
2.11
1.17
1.8
0.85
Mean Cmax (ng/mL)
1.10
0.0528
0.853
0.0441
Mean AUClast (hr * ng/mL)
5.325
0.1297
6.321
0.1151
Mean AUCinf (hr * ng/mL)
5.938
0.1346
7.339
0.1208
Mean T1/2
10.10
1.22
20.33
2.06
Absolute Bioavailability
75%
—
25%
—
TABLE 7
Selected Pharmacokinetic Parameters for Buprenorphine
and Free Naloxone for high dose formulations
Formulation 4 (3.0 mg
Suboxone ® (8.0 mg
buprenorphine/0.75 mg naloxone,
buprenorphine/2.0 mg
backing layer at pH 4.25)
naloxone)
Pharmacokinetic
Free
Free
Parameter
Buprenorphine
Naloxone
Buprenorphine
Naloxone
Mean Tmax (hr)
2.17
1.05
1.70
0.92
Mean Cmax (ng/mL)
3.44
0.233
3.21
0.152
Mean AUClast (hr * ng/mL)
19.46
0.5815
23.05
0.4529
Mean AUCinf (hr * ng/mL)
21.50
0.5884
29.76
0.471
Mean T1/2
18.82
2.80
29.21
6.33
Absolute Bioavailability
65%
—
25%
—
The results indicate that, unexpectedly, the absorption of buprenorphine from Formulations 3 and 4 are increased, as compared to control. This increase in buprenorphine absorption is particularly surprising in view of the results of Example 2 and is caused by the change of pH of the backing layer from 2.8 in Formulations 1 and 2 to 4.25 in Formulations 3 and 4.
The results also indicate that Cmax values for buprenorphine from Formulations 3 and 4 are comparable to values from the control Suboxone® tablets and that the AUCinf values for buprenorphine from the devices of the invention are slightly less than the values from the corresponding Suboxone® tablets. Further, the Cmax and AUCinf values for free (unconjugated) naloxone are greater than the values from the corresponding Suboxone® tablets.
Example 4
Absorption Profiles for Formulations 5, 6 and 7
This study was designed to assess the plasma pharmacokinetic parameters for buprenorphine and naloxone exposure following administration of Formulations 5, 6 and 7 comprising buprenorphine and naloxone present at the w/w ratio of 6:1 of buprenorphine to naloxone and with the backing layer formulated at pH of 4.25. This study was also designed to demonstrate the linearity of buprenorphine exposure across the range of doses. In addition, pharmacokinetic profiles following administration of four devices prepared according to formulation 5 (4×0.875/0.15 mg buprenorphine/naloxone) was compared with those from a single device prepared according to formulation 6 that contained an equivalent dose of actives (3.5/0.6 mg buprenorphine/naloxone).
This was an open label, single dose, 4-period crossover study in 20 healthy subjects. Each subject received 4 doses of buprenorphine in the devices of the invention in a random sequence, each dose separated by at least 7 days. The doses administered were 0.875/0.15 mg, 3.5/0.6 mg, 5.25/0.9 mg and 4×0.875/0.15 mg buprenorphine/naloxone in the devices prepared according to Formulations 5, 6, 7 and 5, respectively. Naltrexone was co-administered approximately 12 hours and 30 minutes prior to and approximately 12 and 24 hours after the single study drug doses. Serial blood samples for pharmacokinetic analyses were collected pre-dose and 15, 30, 45, 60, 75, 90, 105, 120, 135, 150, 165, 180, 210, 240, 270, 300, 330 and 360 minutes post-dose and at 8, 10, 12, 24 and 48 hours post-dose. Blood samples were analyzed using the established procedures utilizing liquid chromatography and mass spectrometry (LC/MS). The selected pharmacokinetic parameters for buprenorphine and free naloxone are shown in Tables 8 and 9.
TABLE 8
Selected Pharmacokinetic Parameters for Buprenorphine
and Free Naloxone for formulations 5 and 7
Formulation 5 (0.875 mg
Formulation 7 (5.25 mg
buprenorphine/0.15 mg naloxone,
buprenorphine/0.875 mg naloxone,
backing layer at pH 4.25)
backing layer at pH 4.25)
Pharmacokinetic
Free
Free
Parameter
Buprenorphine
Naloxone
Buprenorphine
Naloxone
Mean Tmax (hr)
2.84
1.13
2.71
1.38
Mean Cmax (ng/mL)
1.15
0.0443
5.13
0.182
Mean AUClast (hr * ng/mL)
7.372
0.1166
33.28
0.4892
Mean AUCinf (hr * ng/mL)
8.380
0.1202
36.19
0.5233
Absolute Bioavailability
~60%
—
~60%
—
TABLE 9
Selected Pharmacokinetic Parameters for Buprenorphine and Free Naloxone
for formulation 6 and formulation 5 administered as 4 doses
Formulation 6 (3.5 mg
4 x Formulation 5 (0.875 mg
buprenorphine/0.6 mg naloxone,
buprenorphine/0.15 mg naloxone,
backing layer at pH 4.25)
backing layer at pH 4.25)
Pharmacokinetic
Free
Free
Parameter
Buprenorphine
Naloxone
Buprenorphine
Naloxone
Mean Tmax (hr)
2.78
1.48
2.75
1.38
Mean Cmax (ng/mL)
4.03
0.179
3.89
0.182
Mean AUClast (hr * ng/mL)
24.77
0.4801
25.33
0.4892
Mean AUCinf (hr * ng/mL)
27.32
0.4883
27.29
0.5233
Absolute Bioavailability
~60%
—
—
—
The results of the study indicate that changing the w/w ratio of buprenorphine to naloxone from 4:1 to 6:1 results in decreased naloxone exposure that I s more in line with the exposure needed to precipitate withdrawal if abused but not so much as to precipitate the withdrawal if used as indicated. The results also indicate that Cmax and AUCinf of buprenorphine from formulations 5, 6 and 7 is dose proportional. Dose proportionality of buprenorphine Cmax and AUCinf are also illustrated by the graphs shown in FIGS. 2 and 3, respectively.
Example 5
Naloxone Withdrawal Study
The transmucosal devices of the invention that are prepared according to Formulations 1, 3 and 5 comprise relatively small doses of buprenorphine and naloxone (0.75 mg/0.19 mg and 0.875/0.15 mg buprenorphine/naloxone, as compared to 2 mg/0.5 mg buprenorphine/naloxone contained in the equivalent Suboxone® tablet). While the lower dose of the naloxone may be beneficial for the patient using the product correctly, it may not produce the expected aversive reaction experienced by those who are dependent on full-agonist opioids. Accordingly, the objective of the study was to determine the minimum effective dose of naloxone that will produce a withdrawal response when administered with a 0.75 mg dose of buprenorphine in opioid dependent subjects. The secondary objective of the study was to determine whether administration of a 0.75 mg dose of buprenorphine without naloxone will produce a withdrawal response in opioid dependent subjects.
Study Population
The study was designed to include a total of 12 adult subjects that completed the 4-period crossover. Subjects were eligible for inclusion in the study if all the following criteria applied:
subjects experienced chronic moderate to severe non-cancer pain that has been treated >100 mg morphine equivalents per day for at least 3 months prior to the study;
subjects displayed signs and symptoms of withdrawal (i.e., COWS score ≧5) following naloxone administration during the Naloxone Challenge.
Description of Study Medication
During the inpatient Treatment Visit subjects received a single, 3 mL IV bolus dose of each of the following treatments separated by at least 72 hours:
a) Buprenorphine 0.75 mg (B)
b) Buprenorphine 0.75 mg+naloxone 0.1 mg (BN1)
c) Buprenorphine 0.75 mg+naloxone 0.2 mg (BN2)
d) Placebo (5% dextrose) (P)
Study Procedures
Eligible subject exhibited signs of withdrawal, e.g., had a positive response (COWS≧5) to the Naloxone Withdrawal Test, following administration of up to eight 0.05 mg IV doses of naloxone.
Clinical Opiate Withdrawal Scale
The Clinical Opiate Withdrawal Scale (COWS) was used to evaluate symptoms of opioid withdrawal. The scale contains 11 items to rate signs and symptoms of opioid withdrawal including pulse rate, gastrointestinal upset, sweating, tremor, restlessness, yawning, pupil size, anxiety or irritability, bone or joint aches, gooseflesh skin, runny nose, tearing. Each symptom is rated on a unique scale. Total scores for the scale range from 0 to 48 with scores of 5-12 indicating mild withdrawal; scores of 13-24 indicating moderate withdrawal; scores of 25-36 indicating moderately severe withdrawal; and scores >36 indicating severe withdrawal.
Opioid Agonist Scale
Subjects were asked to evaluate the following items: nodding, heavy or sluggish feeling, dry mouth, carefree, good mood, energetic, turning of stomach, skin itchy, relaxed, coasting, soapbox, pleasant sick, drive, drunken, friendly, and nervous using a 5-point Likert scale (0=not at all, 1=a little, 2=moderately, 3=quite a bit, and 4=extremely).
Statistical Analysis
Descriptive statistics were used to summarize the results from the PD analyses at each timepoint for each treatment group, without formal statistical testing. A mixed effect model was fitted to the data for the change from baseline in total score where the model included factors for: the overall mean change; fixed effects due to sequence; treatment, time and period; and a random effect for subject nested within sequence. The least squares mean changes and standard errors were obtained and used to construct 95% CI for differences between treatments in a pair-wise fashion. Subject data collected after rescue time (i.e., time at which the subjects reaches COWS total score of 13 or more) were excluded to minimize the confounding effect of rescue on the PD analyses.
For COWS total score only, Time-to-Total score of ≧13 was calculated as time (hours) from first dose until the subject reports a total score of ≧13. Subjects who did not reach a total score of 13 or more were censored at 24 hours. This endpoint was summarized using the Kaplan-Meier method and 95% CI presented for median for each treatment arm.
Results
COWS Total-Score, and Rescue Results
The number of subjects with COWS total score of at least 7 in the first hour post dose is shown on the left side of FIG. 4. Eight subjects on buprenorphine alone had a COWS value of at least 7 compared with 9 in the buprenorphine plus naloxone 0.1 mg group, 12 subjects in the buprenorphine plus naloxone 0.2 mg group, and two on placebo. Similarly, COWS≧13 were recorded for 6 buprenorphine subjects, 9 buprenorphine and naloxone 0.1 mg subjects, 10 buprenorphine and naloxone 0.2 mg, and 2 placebo patients. Two of the 15 subjects experienced withdrawal on each of the study treatments, including placebo.
In the buprenorphine alone group, 7(47%) of the 15 subjects experienced moderate withdrawal with COWS score of at least 13, and all 7 were rescued. In the 8 subjects that did not receive rescue, the median COWS at 1 hour post dose was 1.
In the buprenorphine plus 0.1 mg of naloxone group, 9 subjects (60%) had COWS≧13 and all 9, plus an additional subject that was rescued. In the 5 subjects that did not receive rescue, the median COWS at one hour post dose was 0.
In the buprenorphine plus 0.2 mg of naloxone group, 11 subjects (73%) had COWS scores of at least 13 and each of these received rescue. In the 4 subjects that were not rescued, the median COWS at one hour post dose was 3.
TABLE 10
Summary of COWS Total Scores and Rescue Results
B
BN1
BN2
P
Parameter
(n = 15)
(n = 15)
(n = 15)
(n = 15)
COWS >= 13, n (%)
7 (47%)
9 (60%)
11 (73%)
2 (1%)
Rescued n (%)
7 (47%)
10 (67%)
11 (73%)
2 (1%)
Median COWS
1
0
3
0
at One Hour
Post Dose
Drug Effect Questionnaire (DEQ)—Observed Median Values 1 Hour Post Dose
Median DEQ responses at one hour in those subjects that were not rescued are shown in Table 6 below.
The median DEQ scores for each parameter in all but the BN2 group were zero or nearly zero at one hour post dose. In contrast, the BN2 group had significantly higher scores on drug effect, nausea, bad effect, dizziness, and feeling sick.
The median score for good effect and how high are you was zero at one hour in all treatment groups.
TABLE 11
Median DEQ responces at one hour
in subjects who were not rescued.
B
BN1
BN2
P
Parameter
(n = 15)
(n = 15)
(n = 15)
(n = 15)
Drug effect
2
0
49
0
Nausea
0
0
38
0
Like drug
0
0
0
0
Good effect
0
0
0
0
Bad Effect
0
0
27
0
Dizzy
0
0
14
0
Feel Sleepy
0
0
0
0
Feel sick
0
0
30
0
How high are you
0
0
0
0
The results of this double-blind, placebo controlled study in opioid dependent subjects indicate that intravenous buprenorphine doses of 0.75 mg have little abuse potential, and that the addition of naloxone increases both the incidence of withdrawal as well as negative drug evaluations. Thus, naloxone at doses of 0.1 and 0.2 mg, provide an abuse deterrent effect to a 0.75 mg dose of buprenorphine when administered intravenously to opioid dependent subjects.
EQUIVALENTS
While the present invention has been described in conjunction with various embodiments and examples it is not intended that the present teachings be limited to such embodiments or examples. On the contrary, the present invention encompasses various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
|
13590094
|
biodelivery sciences international, inc.
|
USA
|
B2
|
Utility Patent Grant (with pre-grant publication) issued on or after January 2, 2001.
|
Open
|
424/443
|
|
Mar 30th, 2022 06:04PM
|
Mar 30th, 2022 06:04PM
|
BioDelivery Sciences
|
|
Pharmaceuticals & Biotechnology
|
|
nasdaq:bdsi
|
BioDelivery Sciences
|
Apr 3rd, 2012 12:00AM
|
Jul 15th, 2011 12:00AM
|
https://www.uspto.gov?id=US08147866-20120403
|
Transmucosal delivery devices with enhanced uptake
|
The present invention provides methods for enhancing transmucosal uptake of a medicament, e.g., fentanyl or buprenorphine, to a subject and related devices. The method includes administering to a subject a transmucosal drug delivery device comprising the medicament. Also provided are devices suitable for transmucosal administration of a medicament to a subject and methods of their administration and use. The devices include a medicament disposed in a mucoadhesive polymeric diffusion environment and a barrier environment.
|
8147866
|
1. A method for providing enhanced uptake of buprenorphine to a subject by direct transmucosal delivery of buprenorphine, the method comprising:
administering buprenorphine to a subject by application of a mucoadhesive bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising:
a bioerodable mucoadhesive layer comprising an effective amount of buprenorphine disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment is a buffered environment having a pH of between about 4 and about 6; and
a barrier layer comprising a polymeric barrier environment disposed adjacent to the mucoadhesive layer to provide a unidirectional gradient upon application to a mucosal surface for the rapid and efficient delivery of buprenorphine,
wherein the unidirectional gradient delivers buprenorphine across the buffered polymeric diffusion environment upon application to the mucosal surface.
2. The method of claim 1, wherein the pH of the polymeric diffusion environment is between about 4.5 and about 5.5.
3. The method of claim 1, wherein the pH of the polymeric diffusion environment is between about 4.5 and about 5.
4. The method of claim 1, wherein a first quantifiable plasma concentration of buprenorphine is observed at about 45 minutes.
5. The method of claim 1, wherein an effective plasma concentration of buprenorphine is maintained for at least 4 hours.
6. The method of claim 1, wherein the device further comprises an opioid antagonist selected from the group consisting of naloxone, naltrexone, nalmefene, nalide, nalmexone, nalorphine, nalbuphine, cyclazocine, levallorphan and combinations thereof.
7. The method of claim 6, wherein the opioid antagonist is naloxone.
8. A mucoadhesive bioerodable drug delivery device suitable for direct transmucosal administration of buprenorphine to a subject, the mucoadhesive bioerodable drug delivery device comprising:
a bioerodable mucoadhesive layer comprising an effective amount of buprenorphine disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment is a buffered environment having a pH between about 4 and about 6; and
a barrier layer comprising a polymeric barrier environment disposed adjacent to the mucoadhesive layer to provide a unidirectional gradient upon application to a mucosal surface for the rapid and efficient delivery of buprenorphine,
wherein the unidirectional gradient delivers buprenorphine across the buffered polymeric diffusion environment.
9. The device of claim 8, wherein the pH of the polymeric diffusion environment is between about 4.5 and about 5.5.
10. The device of claim 8, wherein the pH of the polymeric diffusion environment is between about 4.5 and about 5.
11. The device of claim 8, wherein the device further comprises an opioid antagonist selected from the group consisting of naloxone, naltrexone, nalmefene, nalide, nalmexone, nalorphine, nalbuphine, cyclazocine, levallorphan and combinations thereof.
12. The device of claim 11, wherein the opioid antagonist is naloxone.
|
12
|
RELATED APPLICATIONS
This application is a continuation of U.S. patent application Ser. No. 11/817,915, filed Sep. 6, 2007, which is a U.S. National Phase of PCT/US2007/016634, filed Jul. 23, 2007. U.S. patent application Ser. No. 11/817,915 claims priority to U.S. Provisional Application No. 60/832,725, filed Jul. 21, 2006, U.S. Provisional Application No. 60/832,726, filed Jul. 21, 2006, and U.S. Provisional Application No. 60/839,504, filed Aug. 23, 2006. The entire contents of these applications are incorporated herein by this reference. This application is also related to U.S. Ser. No. 11/639,408, filed Dec. 13, 2006, and PCT/US2006/47686, also filed Dec. 13, 2006, both of which claim priority to U.S. Provisional Application No. 60/750,191, filed Dec. 13, 2005, and 60/764,618, filed Feb. 2, 2006. The entire contents of these applications are also incorporated herein by this reference.
BACKGROUND
U.S. Pat. No. 6,264,981 (Zhang et al.) describes delivery devices, e.g., tablets of compressed powders that include a solid solution micro-environment formed within the drug formulation. The micro-environment includes a solid pharmaceutical agent in solid solution with a dissolution agent that that facilitates rapid dissolution of the drug in the saliva. The micro-environment provides a physical barrier for preventing the pharmaceutical agent from being contacted by other chemicals in the formulation. The micro-environment may also create a pH segregation in the solid formulation. The pH of the micro-environment is chosen to retain the drug in an ionized form for stability purposes. The rest of the formulation can include buffers so that, upon dissolution in the oral cavity, the pH is controlled in the saliva such that absorption of the drug is controlled.
US Publication 2004/0253307 also describes solid dosage forms that include buffers that upon dissolution of the solid dosage form maintains the pharmaceutical agent at a desired pH to control absorption, i.e., to overcome the influence of conditions in the surrounding environment, such as the rate of saliva secretion, pH of the saliva and other factors.
BRIEF SUMMARY OF THE INVENTION
The present invention provides transmucosal devices for enhanced uptake of a medicament and methods of making and using the same. In some embodiments, the devices generally include a mucoadhesive polymeric diffusion environment that facilitates not only the absorption of the medicament across the mucosal membrane to which it is applied, but additionally, the permeability and/or motility of the medicament through the mucoadhesive polymeric diffusion environment to the mucosa.
Accordingly, in one embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of a fentanyl or fentanyl derivative to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: a fentanyl or fentanyl derivative disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface and the fentanyl or fentanyl derivative is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of a fentanyl or fentanyl derivative disposed in a mucoadhesive polymeric diffusion environment such that the effective amount of the fentanyl or fentanyl derivative is delivered in less than about 30 minutes. In some embodiments, chronic pain is alleviated in the subject. In other embodiments, acute pain is alleviated in the subject. In other embodiments, the pain is breakthrough cancer pain.
In yet another embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of a fentanyl or fentanyl derivative to a subject. The mucoadhesive device generally includes a fentanyl or fentanyl derivative disposed in a polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is upon application to a mucosal surface.
In another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative with at least 50% direct buccal absorption and an absolute bioavailability of at least about 70%. In yet another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative directly to the mucosa to achieve onset of pain relief (Tfirst) of about 0.20 hours or less and time to peak plasma concentration (Tmax) of about 1.6 hours or more. In still another embodiment, the present invention is directed to devices comprising about 800 μg of fentanyl, which exhibit upon transmucosal administration to a subject at least one in vivo plasma profile as follows: a Cmax of about 1.10 ng/mL or more; a Tfirst of about 0.20 hours or less; and an AUC0-24 of about 10.00 hr·ng/mL, or more. In yet another embodiment, the present invention is directed to transmucosal delivery devices which include a fentanyl or fentanyl derivative that delivers the fentanyl or fentanyl derivative in an amount effective to treat pain, wherein oral irritation, oral ulceration and/or constipation associated with the delivery of the fentanyl or fentanyl derivative is insignificant or eliminated. In one embodiment, the pH of the mucoadhesive polymeric diffusion environment is between about 6.5 and about 8, e.g., about 7.25. In one embodiment, the device comprises about 800 μg of fentanyl. In another embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the fentanyl or fentanyl derivative to the mucosa. In another embodiment, the fentanyl is fentanyl citrate.
In one embodiment, more than 30% of the fentanyl, e.g., more than 55% of the fentanyl, in the device becomes systemically available via mucosal absorption.
In one embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of buprenorphine to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: buprenorphine disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface, and the buprenorphine is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of buprenorphine disposed in a mucoadhesive polymeric diffusion environment such that the effective amount of the buprenorphine is delivered in less than about 30 minutes. In some embodiments, chronic pain is alleviated in the subject. In other embodiments, acute pain is alleviated in the subject. In other embodiments, the pain is breakthrough cancer pain.
In yet another embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of buprenorphine to a subject. The mucoadhesive device generally includes buprenorphine disposed in a polymeric diffusion environment; and a bather environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to a mucosal surface. In one embodiment, the pH is between about 4.0 and about 7.5, e.g., about 6.0 or about 7.25. In another embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the buprenorphine to the mucosa.
In one embodiment of the methods and devices of the present invention, the device comprises a pH buffering agent. In one embodiment of the methods and devices of the present invention, the device is adapted for buccal administration or sublingual administration.
In one embodiment of the methods and devices of the present invention, the device is a mucoadhesive disc. In one embodiment of the methods and devices of the present invention, the medicament is formulated as a mucoadhesive film formed to delineate different dosages. In one embodiment of the methods and devices of the present invention, the device comprises a backing layer disposed adjacent to the mucoadhesive polymeric diffusion environment.
In one embodiment of the methods and devices of the present invention, the device further comprises an opioid antagonist. In one embodiment of the methods and devices of the present invention, the device further comprises naloxone.
In one embodiment of the methods and devices of the present invention, the device is a layered, flexible device. In one embodiment of the methods and devices of the present invention, the mucoadhesive polymeric diffusion environment has a buffered environment for the transmucosal administration.
In one embodiment of the methods and devices of the present invention, there is substantially no irritation at the site of transmucosal administration. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 30 minutes.
In one embodiment of the methods and devices of the present invention, the polymeric diffusion environment comprises at least one ionic polymer system, e.g., polyacrylic acid (optionally crosslinked), sodium carboxymethylcellulose and mixtures thereof. In one embodiment, the polymeric diffusion environment comprises a buffer system, e.g., citric acid, sodium benzoate or mixtures thereof. In some embodiments, the device has a thickness such that it exhibits minimal mouth feel. In some embodiments, the device has a thickness of about 0.25 mm.
In some embodiments, the present invention provides a flexible, bioerodable mucoadhesive delivery device suitable for direct transmucosal administration of an effective amount of a fentanyl, fentanyl derivative, buprenorphine or buprenorphine derivative to a subject. The mucoadhesive device includes a mucoadhesive layer comprising a fentanyl, fentanyl derivative, buprenorphine or buprenorphine derivative disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH of about 7.25 for the fentanyl or fentanyl derivative or a pH of about 6 for the buprenorphine or buprenorphine derivative; and a backing layer comprising a barrier environment which is disposed adjacent to and coterminous with the mucoadhesive layer. The device has no or minimal mouth feel and is able to transmucosally deliver the effective amount of the fentanyl derivative, buprenorphine or buprenorphine derivative in less than about 30 minutes; and wherein a unidirectional gradient is created upon application of the device to a mucosal surface.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other aspects, embodiments, objects, features and advantages of the invention can be more fully understood from the following description in conjunction with the accompanying figures.
FIGS. 1 and 2 are graphs comparing fentanyl citrate uptake in humans over 2 days post-administration, and 1 hour post-administration, respectively, for exemplary embodiments of the present invention and a commercially available delivery device (Actiq® Oral Transmucosal Fentanyl Citrate) as described in Examples 1 and 2.
FIG. 3 is a graph comparing buprenorphine uptake in humans over 16 hours post-administration, respectively, for exemplary embodiments of the present invention and a commercially available delivery devices as described in Examples 3 and 4.
FIGS. 4A-C are schematic representations of exemplary embodiments of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based, at least in part, on the discovery that transmucosal uptake of medicaments can be enhanced by employing a novel polymeric diffusion environment. Such a polymeric diffusion environment is advantageous, e.g., because the absolute bioavailability of the medicament contained therein is enhanced, while also providing a rapid onset. Additionally, less medicament is needed in the device to deliver a therapeutic effect versus devices of the prior art. This renders the device less abusable, an important consideration when the medicament is a controlled substance, such as an opioid. The polymeric diffusion environment described in more detail herein, provides an enhanced delivery profile and more efficient delivery of the medicament. Additional advantages of a polymeric diffusion environment are also described herein.
In order to more clearly and concisely describe the subject matter of the claims, the following definitions are intended to provide guidance as to the meaning of terms used herein.
As used herein, the articles “a” and “an” mean “one or more” or “at least one,” unless otherwise indicated. That is, reference to any element of the present invention by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present.
As used herein, the term “acute pain” refers to pain characterized by a short duration, e.g., three to six months. Acute pain is typically associated with tissue damage, and manifests in ways that can be easily described and observed. It can, for example, cause sweating or increased heart rate. Acute pain can also increase over time, and/or occur intermittently.
As used herein, the term “chronic pain” refers to pain which persists beyond the usual recovery period for an injury or illness. Chronic pain can be constant or intermittent. Common causes of chronic pain include, but are not limited to, arthritis, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), repetitive stress injuries, shingles, headaches, fibromyalgia, and diabetic neuropathy.
As used herein, the term “breakthrough pain” refers to pain characterized by frequent and intense flares of moderate to severe pain which occur over chronic pain, even when a subject is regularly taking pain medication. Characteristics of breakthrough pain generally include: a short time to peak severity (e.g., three to five minutes); excruciating severity; relatively short duration of pain (e.g., 15 to 30 minutes); and frequent occurrence (e.g., one to five episodes a day). Breakthrough pain can occur unexpectedly with no obvious precipitating event, or it can be event precipitated. The occurrence of breakthrough pain is predictable about 50% to 60% of the time. Although commonly found in patients with cancer, breakthrough pain also occurs in patients with lower back pain, neck and shoulder pain, moderate to severe osteoarthritis, and patients with severe migraine.
As used herein, unless indicated otherwise, the term “fentanyl”, includes any pharmaceutically acceptable form of fentanyl, including, but not limited to, salts, esters, and prodrugs thereof. The term “fentanyl” includes fentanyl citrate. As used herein, the term “fentanyl derivative” refers to compounds having similar structure and function to fentanyl. In some embodiments, fentanyl derivatives include those of the following formula:
or pharmaceutically acceptable salts or esters thereof, wherein
R1 is selected from an aryl group, a heteroaryl group or a —COO—C1-4 alkyl group; and R2 is selected from —H, a —C1-4 alkyl-O—C1-4 alkyl group or a —COO—C1-4 alkyl group.
Fentanyl derivatives include, but are not limited to, alfentanil, sufentanil, remifentanil and carfentanil.
As used herein, unless indicated otherwise, the term “buprenorphine”, includes any pharmaceutically acceptable form of buprenorphine, including, but not limited to, salts, esters, and prodrugs thereof. As used herein, the term “buprenorphine derivative” refers to compounds having similar structure and function to buprenorphine. In some embodiments, fentanyl derivatives include those of the following formula:
or pharmaceutically acceptable salts or esters thereof, wherein
is a double or single bond; R3 is selected from a —C1-4 alkyl group or a cycloalkyl-substituted-C1-4 alkyl group; R4 is selected from a —C1-4 alkyl; R5 is —OH, or taken together, R4 and R3 form a ═O group; and R6 is selected from —H or a —C1-4 alkyl group.
Buprenorphine derivatives include, but are not limited to, etorphine and diprenorphine.
As used herein, “polymeric diffusion environment” refers to an environment capable of allowing flux of a medicament to a mucosal surface upon creation of a gradient by adhesion of the polymeric diffusion environment to a mucosal surface. The flux of a transported medicament is proportionally related to the diffusivity of the environment which can be manipulated by, e.g., the pH, taking into account the ionic nature of the medicament and/or the ionic nature polymer or polymers included in the environment and.
As used herein, “barrier environment” refers to an environment in the form of, e.g., a layer or coating, capable of slowing or stopping flux of a medicament in its direction. In some embodiments, the barrier environment stops flux of a medicament, except in the direction of the mucosa. In some embodiments, the barrier significantly slows flux of a medicament, e.g., enough so that little or no medicament is washed away by saliva.
As used herein, the term “unidirectional gradient” refers to a gradient which allows for the flux of a medicament (e.g., fentanyl or buprenorphine) through the device, e.g., through a polymeric diffusion environment, in substantially one direction, e.g., to the mucosa of a subject. For example, the polymeric diffusion environment may be a mucoadhesive polymeric diffusion environment in the form of a layer or film disposed adjacent to a backing layer or film. Upon mucoadministration, a gradient is created between the mucoadhesive polymeric diffusion environment and the mucosa, and the medicament flows from the mucoadhesive polymeric diffusion environment, substantially in one direction towards the mucosa. In some embodiments, some flux of the medicament is not entirely unidirectional across the gradient; however, there is typically not free flux of the medicament in all directions. Such unidirectional flux is described in more detail herein, e.g., in relation to FIG. 4.
As used herein, “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of preventing, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder (e.g., to alleviate pain).
The term “subject” refers to living organisms such as humans, dogs, cats, and other mammals. Administration of the medicaments included in the devices of the present invention can be carried out at dosages and for periods of time effective for treatment of a subject. In some embodiments, the subject is a human. In some embodiments, the pharmacokinetic profiles of the devices of the present invention are similar for male and female subjects. An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
The term “transmucosal,” as used herein, refers to any route of administration via a mucosal membrane. Examples include, but are not limited to, buccal, sublingual, nasal, vaginal, and rectal. In one embodiment, the administration is buccal. In one embodiment, the administration is sublingual. As used herein, the term “direct transmucosal” refers to mucosal administration via the oral mucosa, e.g., buccal and/or sublingual.
As used herein, the term “water erodible” or “at least partially water erodible” refers to a substance that exhibits a water erodibility ranging from negligible to completely water erodible. The substance may readily dissolve in water or may only partially dissolve in water with difficulty over a long period of time. Furthermore, the substance may exhibit a differing erodibility in body fluids compared with water because of the more complex nature of body fluids. For example, a substance that is negligibly erodible in water may show an erodibility in body fluids that is slight to moderate. However, in other instances, the erodibility in water and body fluid may be approximately the same.
The present invention provides transmucosal delivery devices that uniformly and predictably deliver a medicament to a subject. The present invention also provides methods of delivery of a medicament to a subject employing devices in accordance with the present invention. Accordingly, in one embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of a medicament, e.g., fentanyl or fentanyl derivative or buprenorphine to a subject. The mucoadhesive device generally includes a medicament disposed in a polymeric diffusion environment; and a having a barrier such that a unidirectional gradient is created upon application to a mucosal surface, wherein the device is capable of delivering in a unidirectional manner the medicament to the subject. The present invention also provides methods of delivery of a medicament to a subject employing the devices in accordance with the present invention.
In another embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of a medicament, e.g., fentanyl, fentanyl derivatives and/or buprenorphine, to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: a medicament disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface, wherein an effective amount of the medicament is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of a medicament, e.g., fentanyl, fentanyl derivatives and/or buprenorphine, disposed in a mucoadhesive polymeric diffusion environment having a thickness such that the effective amount of the medicament is delivered in less than about 30 minutes and such that pain is treated. In some embodiments, the medicament is delivered in less than about 25 minutes. In some embodiments, the medicament is delivered in less than about 20 minutes.
In some embodiments of the above methods and devices, an effective amount is delivered transmucosally. In other embodiments, an effective amount is delivered transmucosally and by gastrointestinal absorption. In still other embodiments, an effective amount is delivered transmucosally, and delivery though the gastrointestinal absorption augments and/or maintains treatment, e.g., pain relief for a desired period of time, e.g., at least 1, 1.5, 2, 2.5, 3, 3.5, or 4 or more hours.
In yet another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative directly to the mucosa to achieve onset of pain relief (Tfirst) of about 0.20 hours or less and time to peak plasma concentration (Tmax) of about 1.6 hours or more. The combination of a rapid onset with a delayed maximum concentration is particularly advantageous when treating pain, e.g., relief for breakthrough cancer pain (BTP) in opioid tolerant patients with cancer, because immediate relief is provided to alleviate a flare of moderate to severe pain but persistence is also provided to alleviate subsequent flares. Conventional delivery systems may address either the immediate relief or subsequent flare-ups, but the devices of this embodiment are advantageous because they address both.
TABLE 1
Selected Pharmacokinetic properties of transmucosal devices.
Total
Tfirst
Tmax
Bioavailability
BEMA pH 7.25
0.15 hours
1.61 hours
70%
Actiq ®
0.23 hours
2.28 hours
47%
Fentora ®
0.25 hours*
0.50 hours
65%
*reported as onset of main relief, first time point measured.
The devices of the present invention may have a number of additional or alternative desirable properties, as described in more detail herein. Accordingly, in another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative with at least 50% direct buccal absorption and an absolute bioavailability of at least about 70%. In still another embodiment, the present invention is directed to devices comprising about 800 μg of fentanyl, which exhibit upon transmucosal administration to a subject at least one in vivo plasma profile as follows: a Cmax of about 1.10 ng/mL or more; a Tfirst of about 0.20 hours or less; and an AUC0-24 of about 10.00 hr·ng/mL or more.
The pain can be any pain known in the art, caused by any disease, disorder, condition and/or circumstance. In some embodiments, chronic pain is alleviated in the subject using the methods of the present invention. In other embodiments, acute pain is alleviated in the subject using the methods of the present invention. Chronic pain can arise from many sources including, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), and migraine. Acute pain is typically directly related to tissue damage, and lasts for a relatively short amount of time, e.g., three to six months. In other embodiments, the pain is breakthrough cancer pain. In some embodiments, the methods and devices of the present invention can be used to alleviate breakthrough pain in a subject. For example, the devices of the present invention can be used to treat breakthrough pain in a subject already on chronic opioid therapy. In some embodiments, the devices and methods of the present invention provide rapid analgesia and/or avoid the first pass metabolism of fentanyl, thereby resulting in more rapid breakthrough pain relief than other treatments, e.g., oral medications.
In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 60% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 70% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 80% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 90% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 100% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 25 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 20 minutes.
Without wishing to be bound by any particular theory, it is believed that delivery of the medicament is particularly effective because the mucoadhesive polymeric diffusion environment (e.g., the pH and the ionic nature of the polymers) is such that the medicament (e.g., a weakly basic drug such as fentanyl or buprenorphine) can rapidly move through the mucoadhesive polymeric diffusion environment to the mucosa, while also allowing efficient absorption by the mucosa. For example, in some embodiments, the pH is low enough to allow movement of the medicament, while high enough for absorption.
In some embodiments, the mucoadhesive polymeric diffusion environment is a layer with a buffered pH such that a desired pH is maintained at the mucosal administration site. Accordingly, the effect of any variation in pH encountered in a subject or between subjects (e.g., due to foods or beverages recently consumed), including any effect on uptake, is reduced or eliminated.
Accordingly, one advantage of the present invention is that variability in the properties of the device (e.g., due to changes in the pH of the ingredients) between devices, and from lot to lot is reduced or eliminated. Without wishing to be bound by any particular theory, it is believed that the polymeric diffusion environment of the present invention reduces variation, e.g., by maintaining a buffered pH. Yet another advantage is pH variability at the administration site (e.g., due to what food or drink or other medications was recently consumed) is reduced or eliminated, such that, e.g., the variability of the devices is reduced or eliminated.
A medicament for use in the present invention includes any medicament capable of being administered transmucosally. The medicament can be suitable for local delivery to a particular mucosal membrane or region, such as the buccal and nasal cavities, throat, vagina, alimentary canal or the peritoneum. Alternatively, the medicament can be suitable for systemic delivery via such mucosal membranes.
In one embodiment, the medicament can be an opioid. Opioids suitable for use in the present invention include, e.g., alfentanil, allylprodine, alphaprodine, apomorphine, anileridine, apocodeine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, cyclorphan, cyprenorphine, desomorphine, dextromoramide, dextropropoxyphene, dezocine, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, eptazocine, ethylmorphine, etonitazene, etorphine, fentanyl, fencamfamine, fenethylline, hydrocodone, hydromorphone, hydroxymethylmorphinan, hydroxypethidine, isomethadone, levomethadone, levophenacylmorphan, levorphanol, lofentanil, mazindol, meperidine, metazocine, methadone, methylmorphine, modafinil, morphine, nalbuphene, necomorphine, normethadone, normorphine, opium, oxycodone, oxymorphone, pholcodine, profadol remifentanil, sufentanil, tramadol, corresponding derivatives, physiologically acceptable compounds, salts and bases. In some embodiments, the medicament is fentanyl, e.g., fentanyl citrate. In some embodiments, the medicament is buprenorphine.
The amount of medicament, e.g. fentanyl or buprenorphine, to be incorporated into the device of the present invention depends on the desired treatment dosage to be administered, e.g., the fentanyl or fentanyl derivative can be present in about 0.001% to about 50% by weight of the device of the present invention, and in some embodiments between about 0.005 and about 35% by weight or the buprenorphine can be present in about 0.001% to about 50% by weight of the device of the present invention, and in some embodiments between about 0.005 and about 35% by weight. In one embodiment, the device comprises about 3.5% to about 4.5% fentanyl or fentanyl derivative by weight. In one embodiment, the device comprises about 3.5% to about 4.5% buprenorphine by weight. In another embodiment, the device comprises about 800 μg of a fentanyl such as fentanyl citrate. In another embodiment the device comprises about 25, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, 1600 or 2000 μg of a fentanyl such as fentanyl citrate or fentanyl derivative. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention. In another embodiment, the device comprises about 800 μg of buprenorphine. In another embodiment the device comprises about 100, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, or 2000 μg of buprenorphine. In another embodiment the device comprises about 25, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, 1600 or 2000 μg of any of the medicaments described herein.
One approach to reaching an effective dose is through titration with multiple dosage units such that patients start with a single 200 mcg unit and progressively increase the number of units applied until reaching an effective dose or 800 mcg (4 units) dose as the multiple discs once an effective dose has been identified. Accordingly, in some embodiments, the methods of the present invention also include a titration phase to identify a dose that relieves pain and produces minimal toxicity, because the dose of opioid, e.g., fentanyl, required for control of breakthrough pain episodes is often not easily predicted. The linear relationship between surface area of the devices of the present invention and pharmacokinetic profile may be exploited in the dose titration process through the application of single or multiple discs to identify an appropriate dose, and then substitution of a single disc containing the same amount of medicament.
In one embodiment, the devices of the present invention are capable of delivering a greater amount of fentanyl systemically to the subject than conventional devices. According to the label for Actiq® Oral Transmucosal Fentanyl Citrate, approximately 25% of the fentanyl in the ACTIQ product is absorbed via the buccal mucosa, and of the remaining 75% that is swallowed, another 25% of the total fentanyl becomes available via absorption in the GI tract for a total of 50% total bioavailability. According to Fentora Fentanyl Buccal tablet literature, approximately 48% of the fentanyl in FENTORA product is absorbed via the buccal mucosa, and of the remaining 52%, another 17% of the total fentanyl becomes available via absorption in the GI tract for a total of 65% total bioavailability. Accordingly, in some embodiments, more than about 30% of the fentanyl disposed in the devices of the present invention becomes systemically available or bioavailable via absorption by the mucosa. In some embodiments, more than about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% becomes systemically available via mucosal absorption. In some embodiments, more than about 55%, 60%, 65% or 70% of the fentanyl disposed in the devices of the present invention becomes systemically available or bioavailable by any route, mucosal and/or GI tract. In some embodiments, more than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% becomes systemically available.
Accordingly, another advantage of the devices and methods of the present invention is that because the devices of the present invention more efficiently deliver the medicament, e.g., fentanyl or buprenorphine, than do conventional devices, less medicament can be included than must be included in conventional devices to deliver the same amount of medicament. Accordingly, in some embodiments, the devices of the present invention are not irritating to the mucosal surface on which it attaches. In some embodiments, the devices of the present invention cause little or no constipation, even when the devices include an opioid antagonist such as naloxone. In yet another embodiment, the present invention is directed to transmucosal delivery devices which include a fentanyl or fentanyl derivative that delivers the fentanyl or fentanyl derivative in an amount effective to treat pain, wherein oral irritation, oral ulceration and/or constipation associated with the delivery of the fentanyl or fentanyl derivative is not significant or eliminated.
Another advantage is the devices of the present invention are less subject to abuse than conventional devices because less medicament, e.g., fentanyl or buprenorphine, is required in the device, i.e., there is less medicament to be extracted by an abuser for injection into the bloodstream.
In some embodiments, the devices of the present invention have a dose response that is substantially directly proportional to the amount of medicament present in the device. For example, if the Cmax is 10 ng/mL for a 500 dose, then it is expected in some embodiments that a 1000 μg dose will provide a Cmax of approximately 20 ng/mL. Without wishing to be bound by any particular theory, it is believed that this is advantageous in determining a proper dose in a subject.
In some embodiments, the devices of the present invention further comprise an opioid antagonist in any of various forms, e.g., as salts, bases, derivatives, or other corresponding physiologically acceptable forms. Opioid antagonists for use with the present invention include, but are not limited to, naloxone, naltrexone, nalmefene, nalide, nalmexone, nalorphine, naluphine, cyclazocine, levallorphan and physiologically acceptable salts and solvates thereof, or combinations thereof. In one embodiment, the device further comprises naloxone.
In some embodiments, the properties of the polymeric diffusion environment are effected by its pH. In one embodiment, e.g., when the medicament is fentanyl, the pH of the mucoadhesive polymeric diffusion environment in the devices of the present invention is between about 6.5 and about 8. In another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 7.25. In another embodiment, the pH is between about 7.0 and about 7.5, or between about 7.25 and 7.5. In other embodiments, the pH is about 6.5, 7.0, 7.5, 8.0 or 8.5, or any incremental value thereof. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
In one embodiment, e.g., when the medicament is buprenorphine, the pH of the mucoadhesive polymeric diffusion environment in the devices of the present invention is between about 4.0 and about 7.5. In another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 6.0. In one embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 5.5 to about 6.5, or between about 6.0 and 6.5. In yet another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 7.25. In another embodiment, the pH is between about 7.0 and 7.5, or between about 7.25 and 7.5. In other embodiments, the pH of the device may be about 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, or 7.5, or any incremental value thereof. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
The pH of the mucoadhesive polymeric diffusion environment can be adjusted and/or maintained by methods including, but not limited to, the use of buffering agents, or by adjusting the composition of the device of the present invention. For example, adjustment of the components of the device of the present invention that influence pH, e.g., the amount of anti-oxidant, such as citric acid, contained in the device will adjust the pH of the device.
In some embodiments, the properties of the polymeric diffusion environment are effected by its buffering capacity. In some embodiments, buffering agents are included in the mucoadhesive mucoadhesive polymeric diffusion environment. Buffering agents suitable for use with the present invention include, for example, phosphates, such as sodium phosphate; phosphates monobasic, such as sodium dihydrogen phosphate and potassium dihydrogen phosphate; phosphates dibasic, such as disodium hydrogen phosphate and dipotassium hydrogen phosphate; citrates, such as sodium citrate (anhydrous or dehydrate); bicarbonates, such as sodium bicarbonate and potassium bicarbonate may be used. In one embodiment, a single buffering agent, e.g., a dibasic buffering agent is used. In another embodiment, a combination of buffering agents is employed, e.g., a combination of a tri-basic buffering agent and a monobasic buffering agent.
In one embodiment, the mucoadhesive polymeric diffusion environment of the device will have a buffered environment, i.e., a stabilized pH, for the transmucosal administration of a medicament. The buffered environment of the device allows for the optimal administration of the medicament to a subject. For example, the buffered environment can provide a desired pH at the mucosa when in use, regardless of the circumstances of the mucosa prior to administration.
Accordingly, in various embodiments, the devices include a mucoadhesive polymeric diffusion environment having a buffered environment that reduces or eliminates pH variability at the site of administration due to, for example, medications, foods and/or beverages consumed by the subject prior to or during administration. Thus, pH variation encountered at the site of administration in a subject from one administration to the next may have minimal or no effect on the absorption of the medicament. Further, pH variation at the administration site between different patients will have little or no effect on the absorption of the medicament. Thus, the buffered environment allows for reduced inter- and intra-subject variability during transmucosal administration of the medicament. In another embodiment, the present invention is directed to methods for enhancing uptake of a medicament that include administering to a subject a device including a medicament disposed in a mucoadhesive polymeric diffusion environment having a buffered environment for the transmucosal administration. In yet another embodiment, the present invention is directed to methods of delivering a therapeutically effective amount of a medicament to a subject that include administering a device including a medicament disposed in a mucoadhesive polymeric diffusion environment having a buffered environment for the transmucosal administration.
The devices of the present invention can include any combination or sub-combination of ingredients, layers and/or compositions of, e.g., the devices described in U.S. Pat. No. 6,159,498, U.S. Pat. No. 5,800,832, U.S. Pat. No. 6,585,997, U.S. Pat. No. 6,200,604, U.S. Pat. No. 6,759,059 and/or PCT Publication No. WO 05/06321. The entire contents of these patent and publications are incorporated herein by reference in their entireties.
In some embodiments, the properties of the polymeric diffusion environment are effected by the ionic nature of the polymers employed in the environment. In one embodiment, the mucoadhesive polymeric diffusion environment is water-erodible and can be made from a bioadhesive polymer(s) and optionally, a first film-forming water-erodible polymer(s). In one embodiment, the polymeric diffusion environment comprises at least one ionic polymer system, e.g., polyacrylic acid (optionally crosslinked), sodium carboxymethylcellulose and mixtures thereof.
In some embodiments, the mucoadhesive polymeric diffusion environment can include at least one pharmacologically acceptable polymer capable of bioadhesion (the “bioadhesive polymer”) and can optionally include at least one first film-forming water-erodible polymer (the “film-forming polymer”). Alternatively, the mucoadhesive polymeric diffusion environment can be formed of a single polymer that acts as both the bioadhesive polymer and the first film-forming polymer. Additionally or alternatively, the water-erodible mucoadhesive polymeric diffusion environment can include other first film-forming water-erodible polymer(s) and water-erodible plasticizer(s), such as glycerin and/or polyethylene glycol (PEG).
In some embodiments, the bioadhesive polymer of the water-erodible mucoadhesive polymeric diffusion environment can include any water erodible substituted cellulosic polymer or substituted olefinic polymer wherein the substituents may be ionic or hydrogen bonding, such as carboxylic acid groups, hydroxyl alkyl groups, amine groups and amide groups. For hydroxyl containing cellulosic polymers, a combination of alkyl and hydroxyalkyl groups will be preferred for provision of the bioadhesive character and the ratio of these two groups will have an effect upon water swellability and disperability. Examples include polyacrylic acid (PAA), which can optionally be partially crosslinked, sodium carboxymethyl cellulose (NaCMC), moderately to highly substituted hydroxypropylmethyl cellulose (HPMC), polyvinylpyrrolidone (PVP, which can optionally be partially crosslinked), moderately to highly substituted hydroxyethylmethyl cellulose (HEMC) or combinations thereof. In one embodiment, HEMC can be used as the bioadhesive polymer and the first film forming polymer as described above for a mucoadhesive polymeric diffusion environment formed of one polymer. These bioadhesive polymers are preferred because they have good and instantaneous mucoadhesive properties in a dry, system state.
The first film-forming water-erodible polymer(s) of the mucoadhesive polymeric diffusion environment can be hydroxyalkyl cellulose derivatives and hydroxyalkyl alkyl cellulose derivatives preferably having a ratio of hydroxyalkyl to alkyl groups that effectively promotes hydrogen bonding. Such first film-forming water-erodible polymer(s) can include hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropylmethyl cellulose (HPMC), hydroxyethylmethyl cellulose (HEMC), or a combination thereof. Preferably, the degree of substitution of these cellulosic polymers will range from low to slightly above moderate.
Similar film-forming water-erodible polymer(s) can also be used. The film-forming water-erodible polymer(s) can optionally be crosslinked and/or plasticized in order to alter its dissolution kinetics.
In some embodiments, the mucoadhesive polymeric diffusion environment, e.g., a bioerodable mucoadhesive polymeric diffusion environment, is generally comprised of water-erodible polymers which include, but are not limited to, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethylmethyl cellulose, polyacrylic acid (PAA) which may or may not be partially crosslinked, sodium carboxymethyl cellulose (NaCMC), and polyvinylpyrrolidone (PVP), or combinations thereof. Other mucoadhesive water-erodible polymers may also be used in the present invention. The term “polyacrylic acid” includes both uncrosslinked and partially crosslinked forms, e.g., polycarbophil.
In some embodiments, the mucoadhesive polymeric diffusion environment is a mucoadhesive layer, e.g, a bioerodable mucoadhesive layer. In some embodiments, the devices of the present invention include a bioerodable mucoadhesive layer which comprises a mucoadhesive polymeric diffusion environment.
In some embodiments, the properties of the polymeric diffusion environment are effected by the barrier environment. The barrier environment is disposed such that the flux of medicament is substantially unidirectional. For example, in an exemplary layered device of the present invention, having a layer comprising a medicament dispersed in a polymeric diffusion environment and a co-terminus barrier layer (see, e.g., FIG. 4B), upon application to the mucosa, some medicament may move to and even cross the boundary not limited by the mucosa or barrier layer. In another exemplary layered device of the present invention, a barrier layer does not completely circumscribe the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device (see, e.g., FIG. 4C). A majority of the medicament in both of these cases, however, flows towards the mucosa. In another exemplary layered device of the present invention, having a barrier layer which circumscribes the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device (see, e.g., FIG. 4A), upon application to the mucosa, substantially all of the medicament typically flows towards the mucosa.
The barrier environment can be, e.g., a backing layer. A backing layer can be included as an additional layer disposed adjacent to the mucoadhesive polymeric diffusion environment. The layers can be coterminous, or, e.g., the barrier layer may circumscribe the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device. In one embodiment, the device comprises a backing layer disposed adjacent to the mucoadhesive polymeric diffusion environment. The device of the present invention can also comprise a third layer or coating. A backing layer can be also included in the devices of the present invention as a layer disposed adjacent to a layer which is, in turn, disposed adjacent to the mucoadhesive polymeric diffusion environment (i.e., a three layer device).
In one embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the medicament to the mucosa. In one embodiment, the device of the present invention further comprises at least one additional layer disposed adjacent to the mucoadhesive polymeric diffusion environment. Such layer can include additional medicament or different medicaments, and/or can be present to further reduce the amount of medicament (originally in the mucoadhesive polymeric diffusion environment) that is washed away in the saliva.
Specialty polymers and non-polymeric materials may also optionally be employed to impart lubrication, additional dissolution protection, drug delivery rate control, and other desired characteristics to the device. These third layer or coating materials can also include a component that acts to adjust the kinetics of the erodability of the device.
The backing layer is a non-adhesive water-erodible layer that may include at least one water-erodible, film-forming polymer. In some embodiments, the backing layer will at least partially or substantially erode or dissolve before the substantial erosion of the mucoadhesive polymeric diffusion environment.
The barrier environment and/or backing layer can be employed in various embodiments to promote unidirectional delivery of the medicament (e.g., fentanyl) to the mucosa and/or to protect the muco adhesive polymeric diffusion environment against significant erosion prior to delivery of the active to the mucosa. In some embodiments, dissolution or erosion of the water-erodible non-adhesive backing layer primarily controls the residence time of the device of the present invention after application to the mucosa. In some embodiments, dissolution or erosion of the barrier environment and/or backing layer primarily controls the directionality of medicament flow from the device of the present invention after application to the mucosa.
The barrier environment and/or backing layer (e.g., a water-erodible non-adhesive backing layer) can further include at least one water erodible, film-forming polymer. The polymer or polymers can include polyethers and polyalcohols as well as hydrogen bonding cellulosic polymers having either hydroxyalkyl group substitution or hydroxyalkyl group and alkyl group substitution preferably with a moderate to high ratio of hydroxyalkyl to alkyl group. Examples include, but are not limited to, hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropylmethyl cellulose (HPMC), hydroxyethylmethyl cellulose (HEMC), polyvinyl alcohol (PVA), polyethylene glycol (PEG), polyethylene oxide (PEO), ethylene oxide-propylene oxide co polymers, and combinations thereof. The water-erodible non-adhesive backing layer component can optionally be crosslinked. In one embodiment, the water erodible non-adhesive backing layer includes hydroxyethyl cellulose and hydroxypropyl cellulose. The water-erodible non-adhesive backing layer can function as a slippery surface, to avoid sticking to mucous membrane surfaces.
In some embodiments, the barrier environment and/or backing layer, e.g., a bioerodible non-adhesive backing layer, is generally comprised of water-erodible, film-forming pharmaceutically acceptable polymers which include, but are not limited to, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethylmethyl cellulose, polyvinylalcohol, polyethylene glycol, polyethylene oxide, ethylene oxide-propylene oxide co-polymers, or combinations thereof. The backing layer may comprise other water-erodible, film-forming polymers.
The devices of the present invention can include ingredients that are employed to, at least in part, provide a desired residence time. In some embodiments, this is a result of the selection of the appropriate backing layer formulation, providing a slower rate of erosion of the backing layer. Thus, the non-adhesive backing layer is further modified to render controlled erodibility which can be accomplished by coating the backing layer film with a more hydrophobic polymer selected from a group of FDA approved Eudragit™ polymers, ethyl cellulose, cellulose acetate phthalate, and hydroxyl propyl methyl cellulose phthalate, that are approved for use in other pharmaceutical dosage forms. Other hydrophobic polymers may be used, alone or in combination with other hydrophobic or hydrophilic polymers, provided that the layer derived from these polymers or combination of polymers erodes in a moist environment. Dissolution characteristics may be adjusted to modify the residence time and the release profile of a drug when included in the backing layer.
In some embodiments, any of the layers in the devices of the present invention may also contain a plasticizing agent, such as propylene glycol, polyethylene glycol, or glycerin in a small amount, 0 to 15% by weight, in order to improve the “flexibility” of this layer in the mouth and to adjust the erosion rate of the device. In addition, humectants such as hyaluronic acid, glycolic acid, and other alpha hydroxyl acids can also be added to improve the “softness” and “feel” of the device. Finally, colors and opacifiers may be added to help distinguish the resulting non-adhesive backing layer from the mucoadhesive polymeric diffusion environment. Some opacifers include titanium dioxide, zinc oxide, zirconium silicate, etc.
Combinations of different polymers or similar polymers with definite molecular weight characteristics can be used in order to achieve preferred film forming capabilities, mechanical properties, and kinetics of dissolution. For example, polylactide, polyglycolide, lactide-glycolide copolymers, poly-e-caprolactone, polyorthoesters, polyanhydrides, ethyl cellulose, vinyl acetate, cellulose, acetate, polyisobutylene, or combinations thereof can be used.
The device can also optionally include a pharmaceutically acceptable dissolution-rate-modifying agent, a pharmaceutically acceptable disintegration aid (e.g., polyethylene glycol, dextran, polycarbophil, carboxymethyl cellulose, or poloxamers), a pharmaceutically acceptable plasticizer, a pharmaceutically acceptable coloring agent (e.g., FD&C Blue #1), a pharmaceutically acceptable opacifier (e.g., titanium dioxide), pharmaceutically acceptable anti-oxidant (e.g., tocopherol acetate), a pharmaceutically acceptable system forming enhancer (e.g., polyvinyl alcohol or polyvinyl pyrrolidone), a pharmaceutically acceptable preservative, flavorants (e.g., saccharin and peppermint), neutralizing agents (e.g., sodium hydroxide), buffering agents (e.g., monobasic, or tribasic sodium phosphate), or combinations thereof. Preferably, these components are individually present at no more than about 1% of the final weight of the device, but the amount may vary depending on the other components of the device.
The device can optionally include one or more plasticizers, to soften, increase the toughness, increase the flexibility, improve the molding properties, and/or otherwise modify the properties of the device. Plasticizers for use in the present invention can include, e.g., those plasticizers having a relatively low volatility such as glycerin, propylene glycol, sorbitol, ethylene glycol, diethylene glycol, triethylene glycol, propylene glycol, polypropylene glycol, dipropylene glycol, butylene glycol, diglycerol, polyethylene glycol (e.g., low molecular weight PEG's), oleyl alcohol, cetyl alcohol, cetostearyl alcohol, and other pharmaceutical-grade alcohols and diols having boiling points above about 100° C. at standard atmospheric pressure. Additional plasticizers include, e.g., polysorbate 80, triethyl titrate, acetyl triethyl titrate, and tributyl titrate. Additional suitable plasticizers include, e.g., diethyl phthalate, butyl phthalyl butyl glycolate, glycerin triacetin, and tributyrin. Additional suitable plasticizers include, e.g., pharmaceutical agent grade hydrocarbons such as mineral oil (e.g., light mineral oil) and petrolatum. Further suitable plasticizers include, e.g., triglycerides such as medium-chain triglyceride, soybean oil, safflower oil, peanut oil, and other pharmaceutical agent grade triglycerides, PEGylated triglycerides such as Labrifil®, Labrasol® and PEG-4 beeswax, lanolin, polyethylene oxide (PEO) and other polyethylene glycols, hydrophobic esters such as ethyl oleate, isopropyl myristate, isopropyl palmitate, cetyl ester wax, glyceryl monolaurate, and glyceryl monostearate.
One or more disintegration aids can optionally be employed to increase the disintegration rate and shorten the residence time of the device of the present invention. Disintegration aids useful in the present invention include, e.g., hydrophilic compounds such as water, methanol, ethanol, or low alkyl alcohols such as isopropyl alcohol, acetone, methyl ethyl acetone, alone or in combination. Specific disintegration aids include those having less volatility such as glycerin, propylene glycol, and polyethylene glycol.
One or more dissolution-rate-modifying agents can optionally be employed to decrease the disintegration rate and lengthen the residence time of the device of the present invention. Dissolution-rate modifying agents useful in the present invention include, e.g., hydrophobic compounds such as heptane, and dichloroethane, polyalkyl esters of di and tricarboxylic acids such as succinic and citric acid esterified with C6 to C20 alcohols, aromatic esters such as benzyl benzoate, triacetin, propylene carbonate and other hydrophobic compounds that have similar properties. These compounds can be used alone or in combination in the device of the invention.
The devices of the present invention can include various forms. For example, the device can be a disc or film. In one embodiment, the device comprises a mucoadhesive disc. In one embodiment of the methods and devices of the present invention, the device is a layered, flexible device. The thickness of the device of the present invention, in its form as a solid film or disc, may vary, depending on the thickness of each of the layers. Typically, the bilayer thickness ranges from about 0.01 mm to about 1 mm, and more specifically, from about 0.05 mm to about 0.5 mm. The thickness of each layer can vary from about 10% to about 90% of the overall thickness of the device, and specifically can vary from about 30% to about 60% of the overall thickness of the device. Thus, the preferred thickness of each layer can vary from about 0.005 mm to about 1.0 mm, and more specifically from about 0.01 mm to about 0.5 mm.
In one embodiment, the mucoadhesive polymeric diffusion environment of the device of the present invention has a thickness of about 0.03 mm to about 0.07 mm. In one embodiment, the mucoadhesive polymeric diffusion environment of the device of the present invention has a thickness of about 0.04 mm to about 0.06 mm. In yet another embodiment, the mucoadhesive polymeric diffusion environment of the present invention has a thickness of about 0.05 mm. The thickness of the mucoadhesive polymeric diffusion environment is designed to be thick enough so that it can be easily manufactured, yet thin enough to allow for maximum permeability of the medicament through the layer, and maximum absorption of the medicament into the mucosal layer.
In one embodiment, the backing layer of the device of the present invention has a thickness of about 0.050 mm to about 0.350 mm. In one embodiment, the backing layer of the device of the present invention has a thickness of about 0.100 mm to about 0.300 mm. In yet another embodiment, the backing layer of the present invention has a thickness of about 0.200 mm. The thickness of the backing layer is designed to be thick enough so that it allows for substantially unidirectional delivery of the medicament (towards the mucosa), yet thin enough to dissolve so that it does not have to be manually removed by the subject.
In these embodiments, there is relatively minimal mouth feel and little discomfort because of the thinness and flexibility of the devices as compared to conventional tablet or lozenge devices. This is especially advantageous for patients who have inflammation of the mucosa and/or who may otherwise not be able to comfortably use conventional devices. The devices of the present invention are small and flexible enough so that they can adhere to a non-inflamed area of the mucosa and still be effective, i.e., the mucosa does not need to be swabbed with the device of the present invention.
In various embodiments, the devices of the present invention can be in any form or shape such as a sheet or disc, circular or square in profile or cross-section, etc., provided the form allows for the delivery of the active to the subject. In some embodiments, the devices of the present invention can be scored, perforated or otherwise marked to delineate certain dosages. For example, a device may be a square sheet, perforated into quarters, where each quarter comprises a 200 μg dose. Accordingly, a subject can use the entire device for an 800 μg dose, or detach any portion thereof for a 200 μg, 400 μg or 600 μg dose.
The devices of the present invention can be adapted for any mucosal administration. In some embodiments of the methods and devices of the present invention, the device is adapted for buccal administration and/or sublingual administration.
Yet another advantage of the devices of the present invention is the ease with which they are administered. With conventional devices, the user must hold the device in place, or rub the device over the mucosa for the duration of administration, which may last from twenty to thirty minutes or more. The devices of the present invention adhere to the mucosal surface in less than about five seconds, and naturally erode in about twenty to thirty minutes, without any need to hold the device in place.
Without wishing to be bound by any particular theory, it is also believed that the devices of the present invention are substantially easier to use than devices of the prior art. When devices of the prior art are used, they are often subject to much variability, e.g., due to variation in mouth size, diligence of the subject in correctly administering the device and amount of saliva produced in the subject's mouth. Accordingly, in some embodiments, the present invention provides a variable-free method for treating pain in a subject. The term “variable-free” as used herein, refers to the fact that the devices of the present invention provide substantially similar pharmacokinetic profile in all subjects, regardless of mouth size and saliva production.
Without wishing to be bound by any particular theory, it is also believed that the presence of a backing layer also imparts a resistance to the devices of the present invention. Accordingly, in some embodiments, the devices of the present invention are resistant to the consumption of food or beverage. That is, the consumption of food or beverage while using the devices of the present invention does not substantially interfere with the effectiveness of the device. In some embodiments, the performance of the devices of the present invention, e.g., peak fentanyl concentrations and/or overall exposure to the medicament is unaffected by the consumption of foods and/or hot beverages.
In various embodiments, the devices can have any combination of the layers, ingredients or compositions described herein including but not limited to those described above.
EXEMPLIFICATION
Example 1
Preparation of Devices in Accordance with the Present Invention
Transmucosal devices were configured in the form of a disc, rectangular in shape with round corners, pink on one side and white on the other side. The drug is present in the pink layer, which is the mucoadhesive polymeric diffusion environment, and this side is to be placed in contact with the buccal mucosa (inside the cheek). The drug is delivered into the mucosa as the disc erodes in the mouth. The white side is the non-adhesive, backing layer which provides a controlled erosion of the disc, and minimizes the oral uptake of the drug induced by constant swallowing, thus minimizing or preventing first pass metabolism. The mucoadhesive polymeric diffusion environment and backing layer are bonded together and do not delaminate during or after application.
The backing layer was prepared by adding water (about 77% total formulation, by weight) to a mixing vessel followed by sequential addition of sodium benzoate (about 0.1% total formulation, by weight), methylparaben (about 0.1% total formulation, by weight) and propylparaben (about 0.03% total formulation, by weight), citric acid (about 0.1% total formulation, by weight) and vitamin E acetate (about 0.01% total formulation, by weight), and sodium saccharin (about 0.1% total formulation, by weight). Subsequently, a mixture of the polymers hydroxypropyl cellulose (Klucel EF, about 14% total formulation, by weight) and hydroxyethyl cellulose (Natrosol 250L, about 7% total formulation, by weight) was added and stirred at a temperature between about 120 and 130° F., until evenly dispersed. Upon cooling to room temperature, titanium dioxide (about 0.6% total formulation, by weight) and peppermint oil (about 0.2% total formulation, by weight) were then added to the vessel and stirred. The prepared mixture was stored in an air-sealed vessel until it was ready for use in the coating operation.
The mucoadhesive polymeric diffusion environment was prepared by adding water (about 89% total formulation, by weight) to a mixing vessel followed by sequential addition of propylene glycol (about 0.5% total formulation, by weight), sodium benzoate (about 0.06% total formulation, by weight), methylparaben (about 0.1% total formulation, by weight) and propylparaben (about 0.03% total formulation, by weight), vitamin E acetate (about 0.01% total formulation, by weight) and citric acid (about 0.06% total formulation, by weight), red iron oxide (about 0.01% total formulation, by weight), and monobasic sodium phosphate (about 0.04% total formulation, by weight). After the components were dissolved, 800 μg fentanyl citrate (about 0.9% total formulation, by weight) was added, and the vessel was heated to 120 to 130° F. After dissolution, the polymer mixture [hydroxypropyl cellulose (Klucel EF, about 0.6% total formulation, by weight), hydroxyethyl cellulose (Natrosol 250L, about 1.9% total formulation, by weight), polycarbophil (Noveon AA1 (about 0.6% total formulation, by weight), and carboxy methyl cellulose (Aqualon 7LF, about 5.124% total formulation, by weight)] was added to the vessel, and stirred until dispersed. Subsequently, heat was removed from the mixing vessel. As the last addition step, tribasic sodium phosphate and sodium hydroxide were added to adjust the blend to a desired pH. For example, about 0.6% total formulation, by weight of sodium hydroxide and about 0.4% total by weight of tribasic sodium phosphate can be added to the formulation. Batches were made having pHs of about 6, 7.25, and 8.5. The blend was mixed under vacuum for a few hours. Each prepared mixture was stored in an air-sealed vessel until its use in the coating operation.
The layers were cast in series onto a St. Gobain polyester liner. First, the backing layer was cast using a knife-on-a-blade coating method. The backing layer was then cured in a continuous oven at about 65 to 95° C. and dried. After two coating and drying iterations, an approximately 8 mil (203 to 213 micrometers) thick backing layer is obtained. Subsequently, the mucoadhesive polymeric diffusion environment was cast onto the backing layer, cured in an oven at about 65 to 95° C. and dried. The devices were then die-cut by kiss-cut method and removed from the casting surface.
Example 2
Study of Fentanyl Citrate Uptake in Humans for Delivery Devices of the Present Invention and a Commercially Available Delivery Device
The effect of system pH on the uptake of fentanyl citrate in three exemplary delivery devices of the present invention was evaluated, and compared to that observed in Actiq® Oral Transmucosal Fentanyl Citrate product (Cephalon, Inc., Salt Lake City, Utah), referred to herein as “OTFC”. A randomized, open-label, single-dose, four-period, Latin-square crossover study was conducted in 12 healthy volunteers. An Ethical Review Board approved the study and all subjects gave informed consent before participating. Bioanalytical work using a validated liquid chromatography/mass spectrometry/mass spectrometry (LC/MS/MS) method was performed by CEDRA Clinical Research, LLC (Austin, Tex.).
Twelve (9 male, 3 female) healthy volunteers ranging in age from 21 to 44 years were recruited for the instant study. Subjects tested were free from any significant clinical abnormalities on the basis of medical history and physical examination, electrocardiogram, and screening laboratories. Subjects weighed between about 50 kg and 100 kg and were within 15% of their ideal body weight based on Metropolitan Life tables for height and weight. Subjects were instructed to not consume alcohol, caffeine, xanthine, or foods/beverages containing grapefruit for 48 hours prior to the first dose of study medication and for the entire duration of the study. Subjects were also instructed not to use tobacco or nicotine containing products for at least 30 days prior to the first dose of medication. No subject had participated in any investigational drug study for at least 30 days prior to the instant study; had any significant medical condition either at the time of the study or in the past (including glaucoma and seizure disorders); had a positive drug screen; had used any concomitant medication other than oral contraceptives or acetaminophen for at least 72 hours prior to the first dose; or had a history of allergic reaction or intolerance to narcotics. Premenopausal women not using contraception or having a positive urine beta HCG test were excluded. Table 2, below, shows the demographics of the subjects included in this study.
TABLE 2
Subject Demographics (N = 12)
Age, Years
Mean (standard deviation)
32
(7)
Median
31
Range
21-44
Gender, n (%)
Female
3
(25)
Male
9
(75)
Race, n (%)
Black
3
(25)
Caucasian
4
(33)
Hispanic
5
(42)
Height (cm)
Mean (standard deviation)
171.6
(9.3)
Median
172.0
Range
155.0-183.5
Weight (kg)
Mean (standard deviation)
70.5
(9.0)
Median
70.7
Range
52.0-86.5
The study consisted of a screening visit and a 9-day inpatient period during which each subject received single buccal transmucosal doses of each of the four study treatments with 48 hours separating the doses. The four study treatments, each including 800 μg of fentanyl citrate, were: the OTFC and devices prepared as described in Example 1 and buffered at a pH of about 6 (“device at pH 6”), a pH of about 7.25 (“device at pH 7.25”), and a pH of about 8.5 (“device at pH 8.5”).
Subject eligibility was determined at the screening visit, up to 21 days prior to entering the study facility. Subjects arrived at the study facility at 6:00 PM the day prior to dosing (day 0). Predose procedures (physical examination, clinical laboratory tests, electrocardiogram, and substance abuse screen) were performed. After an overnight fast of at least 8 hours, subjects received an oral dose of naltrexone at 6 AM. A standard light breakfast was served approximately 1 hour prior to study drug dosing. A venous catheter was placed in a large forearm or hand vein for blood sampling, and a pulse oximeter and noninvasive blood pressure cuff were attached. Subjects were placed in a semi-recumbent position, which they maintained for 8 hours after each dose.
Subjects received the first dose of drug at 8 AM on day 1 and subsequent doses at the same time on days 3, 5, and 7. Blood samples (7 mL) were collected in ethylenediaminetetraacetic acid (EDTA) for measurement of plasma fentanyl just prior to dose 1 and 5, 7.5, 10, 15, 20, 25, 30, 45, and 60 minutes, and 2, 3, 4, 8, 12, 16, 20, 24, and 48 hours after each dose. The 48-hour post dose sample was collected just prior to administration of the subsequent dose. A total of 511 mL of blood was collected over the study period for pharmacokinetic analysis. Samples were centrifuged and the plasma portion drawn off and frozen at −20° C. or colder.
Finger pulse oximetry was monitored continuously for 8 hours after each dose and then hourly for an additional four hours. If the subject's oxyhemoglobin saturation persistently decreased to less than 90%, the subject was prompted to inhale deeply several times and was observed for signs of decreased oxyhemoglobin saturation. If the oxyhemoglobin saturation value immediately increased to 90% or above, no further action was taken. If the oxyhemoglobin saturation remained below 90% for more than 1 minute, oxygen was administered to the subject via a nasal cannula. Heart rate, respiratory rate, and blood pressure were measured just prior to the dose, and every 15 minutes for 120 minutes, and at 4, 6, 8, and 12 hours post dose. Throughout the study, subjects were instructed to inform the study personnel of any adverse events.
Each subject received a single buccal dose of each of the 4 study treatments in an open-label, randomized crossover design. The measured pH on the three devices during the manufacturing process in accordance with Example 1 were 5.95 for the device at pH 6.0, 7.44 for the device at pH 7.25, and 8.46 for the device at pH 8.5. After subjects rinsed their mouths with water, the delivery devices of the present invention were applied to the oral mucosa at a location approximately even with the lower teeth. The devices were held in place for 5 seconds until the device was moistened by saliva and adhered to the mucosa membrane. After application, subjects were instructed to avoid rubbing the device with their tongues, as this would accelerate the dissolution of the device.
OTFC doses were administered according to the package insert. After each mouth was rinsed with water, the OTFC unit was placed in the mouth between the cheek and lower gum. The OTFC unit was occasionally moved from one side of the mouth to the other. Subjects were instructed to suck, not chew, the OTFC unit over a 15-minute period. To block the respiratory depressive effects of fentanyl, a 50 mg oral dose of naltrexone was administered to each subject at approximately 12 hours and 0.5 hours prior to each dose of study drug and 12 hours after study drug. Naltrexone has been shown not to interfere with fentanyl pharmacokinetics in opioid naïve subjects. Lor M, et al., Clin Pharmacol Ther; 77: P 76 (2005).
At the end of the study, EDTA plasma samples were analyzed for plasma fentanyl concentrations using a validated liquid chromatography with tandem mass spectrophotometry (LC/MS/MS) procedure. Samples were analyzed on a SCIEX API 3000 spectrophotometer using pentadeuterated fentanyl as an internal standard. The method was validated for a range of 0.0250 to 5.00 ng/mL based on the analysis of 0.500 mL of EDTA human plasma. Quantitation was performed using a weighted (1/X2) linear least squares regression analysis generated from calibration standards.
Pharmacokinetic data were analyzed by noncompartmental methods in WinNonlin (Pharsight Corporation). In the pharmacokinetic analysis, concentrations below the limit of quantitation (<0.0250 ng/mL) were treated as zero from time-zero up to the time at which the first quantifiable concentration (Cfirst) was observed. Subsequent to Cfirst, concentrations below this limit were treated as missing. Full precision concentration data were used for all pharmacokinetic and statistical analyses. Cfirst was defined as the first quantifiable concentration above the pre-dose concentration because quantifiable data were observed in the pre-dose samples in some subjects. λz was calculated using unweighted linear regression analysis on at least three log-transformed concentrations visually assessed to be on the linear portion of the terminal slope. The t1/2 was calculated as the ratio of 0.693 to λz. Pharmacokinetic parameters were summarized by treatment using descriptive statistics. Values of tfirst, tmax, Cmax, and AUCinf of the three exemplary devices of the present invention were compared to OTFC using an analysis of variance (ANOVA) model and Tukey's multiple comparison test. Statistical analysis was performed using SAS (SAS Institute Inc.). Table 3, below, presents the fentanyl pharmacokinetics for all 4 treatments after a single dose.
TABLE 3
Pharmacokinetic Parameters of OTFC and Three
Formulations of BEMA Fentanyl Citrate
Device at pH 6
Device at pH 7.25
Device at pH 8.5
OTFC 800 μg
Fentanyl 800 μg
Fentanyl 800 μg
Fentanyl 800 μg
(N = 12)
(N = 12)
(N = 12)
(N = 12)
Mean
Mean
Mean
Mean
Parameter
(SD)
CV %
(SD)
CV %
(SD)
CV %
(SD)
CV %
tfirst (hr)
0.23
78.03
0.13
27.99
0.15
54.18
0.21
55.21
(0.18)
(0.04)
(0.08)
(0.11)
Cfirst
0.07
64.95
0.05
35.25
0.06
41.59
0.06
30.08
(ng/mL)
(0.05)
(0.02)
(0.02)
(0.02)
tmax (hr)
2.28
58.04
2.15
53.23
1.61
64.49
2.21
60.64
(1.32)
(1.14)
(1.04)
(1.34)
Cmax
1.03
24.19
1.40
35.12
1.67
45.07
1.39
29.44
(ng/mL)1
(0.25)
(0.49)
(0.75)
(0.41)
AUClast
9.04
39.01
12.17
35.19
12.98
43.04
11.82
38.37
(hr · ng/mL)
(3.53)
(4.28)
(5.59)
(4.54)
AUC0-24
7.75
32.48
10.43
28.74
11.38
37.78
10.18
31.44
(hr · ng/mL)
(2.52)
(3.00)
(4.30)
(3.20)
AUCinf
10.30
37.29
13.68
33.24
14.44
37.33
13.11
36.40
(hr · ng/mL)
(3.84)
(4.55)
(5.39)
(4.77)
% AUCextrap
12.15
68.40
11.53
59.33
11.72
58.96
10.31
43.49
(8.31)
(6.84)
(6.91)
(4.49)
λz (hr−1)
0.05
37.83
0.05
31.10
0.05
21.18
0.06
26.98
(0.02)
(0.02)
(0.01)
(0.02)
t1/2 (hr)
15.33
44.67
15.12
33.66
14.28
19.23
13.33
31.04
(6.85)
(5.09)
(2.75)
(4.14)
MRT
15.92
38.73
15.73
26.63
14.45
21.61
14.31
31.09
(6.17)
(4.19)
(3.12)
(4.45)
1Mean differences of BEMA fentanyl formulations and OTFC significantly different by ANOVA, p = 0.0304.
Abbreviations used herein are as follows: Cfirst is the first quantifiable drug concentration in plasma determined directly from individual concentration-time data; tfirst is the time to the first quantifiable concentration; Cmax is the maximum drug concentration in plasma determined directly from individual concentration-time data; tmax is the time to reach maximum concentration; λz is the observed elimination rate constant; t1/2 is the observed terminal elimination half-life calculated as ln(2)/λz; AUC0-24 is the area under the concentration-time curve from time zero to 24 hours post-dose; calculated using the linear trapezoidal rule and extrapolated using the elimination rate constant if quantifiable data were not observed through 24 hours; AUClast is the area under the concentration-time curve from time zero to the time of the last quantifiable concentration; calculated using the linear trapezoidal rule; AUCinf is the area under the concentration-time curve from time zero extrapolated to infinity, calculated as AUClast+Clast/λz; AUCextrap (%) is the percentage of AUCinf based on extrapolation; MRT is the mean residence time, calculated as AUMCinf/AUCinf, where AUMCinf is the area under the first moment curve (concentration-time vs. time), calculated using the linear trapezoidal rule form time zero to Tlast (AUMClast) and extrapolated to infinity. It should be noted that, because quantifiable data were observed in the pre-dose samples for some subjects, Cfirst was redefined as the first quantifiable concentration above the pre-dose concentration, which was set to zero in calculating mean fentanyl concentrations.
FIG. 1 illustrates the plasma fentanyl concentration from 0 to 48 hours post-dose for the OTFC dose and the doses provided by the three exemplary devices of the present invention. The device at pH 7.25 provided the highest peak concentrations of fentanyl of the three devices of the present invention used in this study. In general, OTFC provided lower fentanyl concentrations for most time points as compared with the devices of the present invention. The device at pH 6 and the device at pH 8.5 yielded very similar concentration-time profiles, with Cmax values of 1.40 ng/mL and 1.39 ng/mL, respectively. These values are midway between the maximum plasma fentanyl values of 1.03 ng/mL for OTFC and 1.67 ng/mL for the device at pH 7.25. After approximately 6 hours post-dose, the fentanyl concentration-time profiles for the three devices of the present invention were similar. The differences in fentanyl Cmax values were statistically significant when comparing all of the devices of the present invention to OTFC (p=0.0304), and for pairwise comparisons of the device at pH 7.25 to OTFC (p<0.05).
In general, quantifiable fentanyl concentrations were observed earlier after administration of one of the three exemplary devices of the present invention (mean tfirst of 8 to 13 minutes) compared with OTFC (mean tfirst of 14 minutes). The device at pH 7.25 yielded the earliest average tmax (1.61 hours) and highest Cmax (mean 1.67 ng/mL). As shown in FIG. 2, fentanyl absorption from a device at pH 7.25 was more rapid over the first hour post dose than from OTFC, with 30-minute mean plasma concentrations of 0.9 ng/mL for the device at pH 7.25 and 0.5 ng/mL for OTFC.
The delivery devices of the present invention provided overall greater exposure to fentanyl, based on AUC0-24 as compared to OTFC. Fentanyl exposure as measured by AUC0-24 values, were similar across groups treated with one of the devices of the present invention, suggesting that comparable amounts of fentanyl enter the systemic circulation from each of the devices. The device at pH 7.25, however, demonstrated approximately 19% greater maximum plasma fentanyl concentration.
Overall, fentanyl concentrations were observed earlier and increased more rapidly after administration of a device of the present invention compared with OTFC. Mean 30 and 60 minute plasma fentanyl concentrations observed with use of the device at pH 7.25 were 1.8 and 1.7 times higher than with OTFC, respectively. Similarly, the maximum plasma fentanyl concentration was 60% higher using a device of the present invention (mean 1.67 ng/mL) when compared to use of OTFC (mean 1.03 ng/mL). The Cmax for OTFC identified in this study is nearly identical to the 1.1 ng/mL Cmax value reported by Lee and co-workers with both a single 800 mcg lozenge as well as two 400 mcg lozenges. Lee, M., et al., J Pain Symptom Manage 2003; 26:743-747. Overall, fentanyl exposure for the fentanyl formulations of the present invention were greater than for OTFC. Mean estimates of AUClast and AUCinf were slightly larger, but the same general trends were observed. This indicates that the transmucosal uptake is significantly improved in the devices of the present invention as compared to OTFC.
Mean t1/2 values and MRT values were similar for all treatment groups and the values in both cases followed the same trend. Additionally, because MRT after extravascular administration is dependent on the absorption and elimination rates, the MRT values suggest that fentanyl absorbs faster from a delivery device of the present invention, particularly with the device at pH 7.25 and the device at pH 8.5. This observation is consistent with the tmax for the delivery devices of the present invention relative to OTFC.
Adverse events were similar across treatment groups and confounded by the co-administration of naltrexone with each study treatment. The most frequent adverse events were sedation and dizziness. One subject experienced oral mucosal irritation with OTFC. No subject experienced mucosal irritation with any of the three exemplary devices of the present invention. All reported adverse events were mild or moderate in nature.
As demonstrated above, the delivery devices of the present invention provide significantly higher plasma fentanyl concentrations than OTFC. The delivery device at pH 7.25 appeared to provide enhanced uptake believed to be attributable to a favorable balance between drug solubility and ionization. Similar studies have shown that the delivery devices of the present invention provide an absolute bioavailability of about 70.5% and buccal absorption was about 51% (estimated by subtracting the AUCinf following an oral dose of fentanyl from the AUCinf following BEMA fentanyl applied to the buccal mucosa, dividing by the single disc BEMA Fentanyl AUCinf, and multiplying by 100).
Example 3
Preparation of Devices in Accordance with the Present Invention
Devices containing buprenorphine were also produced using the same method as described in Example 1, except that buprenorphine was added to the mucoadhesive polymeric diffusion environment, rather than fentanyl citrate.
Example 4
Study of Buprenorphine Uptake in Humans for Delivery Devices of the Present Invention
A study similar to that described in Example 2 was also performed with buprenorphine in exemplary devices of the present invention (at pH 6 and 7.25), suboxone sublingual and buprenex intramuscular. Results from this study are summarized in the graph in FIG. 3. As demonstrated in Table 4, the delivery devices of the present invention at pH 6 appeared to provide enhanced uptake believed to be attributable to a favorable balance between drug solubility and ionization.
TABLE 4
Pharmacokinetic data for buprenorphine
pH
6
7.25
tfirst (hr)
0.75
0.75
Cfirst (ng/mL)
0.0521
0.0845
tmax (hr)
3
3
Cmax (ng/mL)1
1.05
0.86
EQUIVALENTS
Numerous modifications and alternative embodiments of the present invention will be apparent to those skilled in the art in view of the foregoing description. Accordingly, this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the best mode for carrying out the present invention. Details of the structure may vary substantially without departing from the spirit of the invention, and exclusive use of all modifications that come within the scope of the appended claims is reserved. It is intended that the present invention be limited only to the extent required by the appended claims and the applicable rules of law.
All literature and similar material cited in this application, including, patents, patent applications, articles, books, treatises, dissertations and web pages, regardless of the format of such literature and similar materials, are expressly incorporated by reference in their entirety. In the event that one or more of the incorporated literature and similar materials differs from or contradicts this application, including defined terms, term usage, described techniques, or the like, this application controls.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described in any way.
While the present inventions have been described in conjunction with various embodiments and examples, it is not intended that the present teachings be limited to such embodiments or examples. On the contrary, the present inventions encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
The claims should not be read as limited to the described order or elements unless stated to that effect. It should be understood that various changes in form and detail may be made without departing from the scope of the appended claims. Therefore, all embodiments that come within the scope and spirit of the following claims and equivalents thereto are claimed.
|
13184306
|
biodelivery sciences international, inc.
|
USA
|
B2
|
Utility Patent Grant (with pre-grant publication) issued on or after January 2, 2001.
|
Open
|
424/435
|
|
Mar 30th, 2022 06:04PM
|
Mar 30th, 2022 06:04PM
|
BioDelivery Sciences
|
|
Pharmaceuticals & Biotechnology
|
|
nasdaq:bdsi
|
BioDelivery Sciences
|
Dec 20th, 2016 12:00AM
|
Dec 13th, 2006 12:00AM
|
https://www.uspto.gov?id=US09522188-20161220
|
Abuse resistant transmucosal drug delivery device
|
The present invention relates to a solid pharmaceutical dosage form for abusable drug delivery with reduced illicit abuse potential. The dosage form is presented as a bioerodable transmucosal delivery device that includes an abusable drug and an antagonist to the abusable drug associated with an abuse-resistant matrix. The devices of the invention may be in the form of a layered film or a tablet. Upon application in a non-abusive manner, the device adheres to the mucosal surface, providing transmucosal drug delivery of the drug with minimal absorption of the antagonist into systemic circulation.
|
9522188
|
1. A bioerodable abuse-resistant transmucosal drug delivery device comprising:
an abusable drug incorporated into a mucoadhesive layer; and
an antagonist to the abusable drug incorporated into an abuse-resistant matrix such that the antagonist is substantially transmucosally unavailable,
wherein the abuse-resistant transmucosal drug delivery device is bioerodable.
2. The delivery device of claim 1, wherein the device is a mucoadhesive drug delivery device.
3. The delivery device of claim 1, wherein either or both of the abusable drug and the abuse-resistant matrix are incorporated into the mucoadhesive layer.
4. The drug delivery device of claim 1, comprising a non-adhesive backing layer.
5. The delivery device of claim 4, wherein the abusable drug is incorporated into a third layer disposed between the mucoadhesive layer and the backing layer.
6. The delivery device of claim 4, wherein the abuse-resistant matrix is incorporated into a third layer disposed between the mucoadhesive layer and the backing layer.
7. The delivery device of claim 4, wherein the abuse-resistant matrix is a third layer disposed between the mucoadhesive layer and the backing layer.
8. The delivery device of claim 4, wherein the abuse-resistant matrix is incorporated into the mucoadhesive layer and/or the backing layer.
9. The delivery device of claim 4, wherein the abuse-resistant matrix is incorporated into the backing layer.
10. The delivery device of claim 5, wherein the abuse-resistant matrix erodes at a slower rate than the backing layer, the mucoadhesive layer, the third layer, or any combination thereof.
11. The delivery device according to claim 1, wherein the abusable drug is selected from the group consisting of opiates and opioids.
12. The delivery device according to claim 1, wherein the device comprises at least one abusable drug selected from the group consisting of: alfentanil, allylprodine, alphaprodine, apomorphine, anileridine, apocodeine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, cyclorphan, cyprenorphine, desomorphine, dextromoramide, dextropropoxyphene, dezocine, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, eptazocine, ethylmorphine, etonitazene, etorphine, fentanyl, fencamfamine, fenethylline, hydrocodone, hydromorphone, hydroxymethylmorphinan, hydroxypethidine, isomethadone, levomethadone, levophenacylmorphan, levorphanol, lofentanil, mazindol, meperidine, metazocine, methadone, methylmorphine, modafinil, morphine, nalbuphene, necomorphine, normethadone, normorphine, opium, oxycodone, oxymorphone, pholcodine, profadol remifentanil, sufentanil, tramadol, corresponding derivatives, physiologically acceptable compounds, salts and bases.
13. The delivery device according to claim 1, wherein the antagonist comprises at least one opiate or opioid antagonist selected from the group consisting of naloxone, naltrexone, nalmefene, nalide, nalmexone, nalorphine, naluphine, cyclazocine, levallorphan and physiologically acceptable salts and solvates thereof.
14. The abuse-resistant drug delivery device of claim 1, wherein the antagonist and the abusable drug are released at substantially the same rate when abusively dissolved.
15. The abuse-resistant drug delivery device of claim 1, wherein the antagonist and the abusable drug are released at substantially the same rate when dissolved in water.
16. The abuse-resistant drug delivery device of claim 14, wherein the ratio of released antagonist to released abusable drug is not less than about 1:20.
17. A method for treating pain in a subject comprising administering a device according to any of the preceding claims such that pain is treated.
18. The method of claim 17, wherein the extent of the absorption into systemic circulation of the antagonist by the subject is less than about 15% by weight.
19. The method of claim 17, wherein the dosage of the abusable drug is between about 50 μg and about 10 mg.
20. A bioerodable abuse-resistant drug delivery device comprising:
a layered film having
at least one bioerodable, mucoadhesive layer to be placed in contact with a mucosal surface, and
at least one bioerodable non-adhesive backing layer,
wherein at least one abusable drug is incorporated in at least the mucoadhesive layer, and an abuse-resistant matrix comprising an antagonist to the abusable drug is incorporated in any or all of the layers such that the antagonist is substantially transmucosally unavailable.
21. The device of claim 1, wherein the device is adapted for a residence time of between about 20 minutes and about 4 hours.
|
21
|
RELATED APPLICATIONS
This application claims the benefit of and priority to U.S. Provisional Application No. 60/750,191, filed on Dec. 13, 2005 and U.S. Provisional Application No. 60/764,619, filed on Feb. 2, 2006. The contents of these applications are hereby incorporated by this reference in their entireties.
BACKGROUND OF THE INVENTION
Opioids, or opioid agonists, refer generally to a group of drugs that exhibit opium or morphine-like properties. Opioids can be employed as moderate to strong analgesics, but have other pharmacological effects as well, including drowsiness, respiratory depression, changes in mood and mental clouding without a resulting loss of consciousness. Opium contains more than twenty distinct alkaloids. Morphine, codeine and papaverine are included in this group. With the advent of totally synthetic entities with morphine-like actions, the term “opioid” was generally retained as a generic designation for all exogenous substances that bind stereo-specifically to any of several subspecies of opioid receptors and produce agonist actions.
The potential for the development of tolerance and physical dependence with repeated opioid use is a characteristic feature of all the opioid drugs, and the possibility of developing psychological dependence (i.e., addiction) is one of the major concerns in the treatment of pain with opioids. Another major concern associated with the use of opioids is the diversion of these drugs from the patient in pain to another (non-patient) for recreational purposes, e.g., to an addict.
While opioids are highly successful in relieving and preventing moderate to severe pain, they are subject to abuse to achieve a state of narcosis or euphoria. Oral intake of such drugs by abusers, however, does not usually give rise to the euphoric result desired by the abuser, even when taken in an abusively large quantity, because of poor uptake of such drugs through the GI tract.
Because a particular dose of an opioid analgesic is typically more potent when administered parenterally as compared to the same dose administered orally, one mode of abuse of oral medications involves the extraction of the opioid from the dosage form, and the subsequent injection of the opioid (using any suitable vehicle for injection) in order to achieve a “high.” Such extraction is generally as easy as dissolving the dosage form using an aqueous liquid or a suitable solvent. Oral opioid formulations, however, are not only being abused by the parenteral route, but also via the oral route when the patient or addict orally self-administers more than the prescribed oral dose during any dosage interval. In another mode of abuse, the corresponding dosage forms are comminuted, for example ground, by the abuser and administered, for example, by inhalation. In still another form of abuse, the opioid is extracted from the powder obtained by comminution of the dosage form (optionally dissolving in a suitable liquid) and inhaling the (dissolved or powdered) opioid. These forms of administration give rise to an accelerated rise in levels of the abusable drug, relative to oral administration, providing the abuser with the desired result.
Some progress has been made in the attempt to alleviate or lessen the problem of opioid abuse. For example, U.S. Pat. No. 5,866,164 proposes an oral osmotic therapeutic system with a two-layer core, wherein the first layer of the core, facing towards the opening of the system comprises an opioid analgesic and the second layer comprises an antagonist for this opioid analgesic and simultaneously effects the push function, i.e., expelling the analgesic from the corresponding layer out of the opening of the system. U.S. Pat. No. 6,228,863 describes an oral dosage form containing a combination of an opioid agonist and an opioid antagonist, the formulation of which has been selected such that the two compounds can in each case only be extracted together from the dosage form and then an at least two-stage process is required to separate them.
U.S. Pat. No. 4,582,835 describes a method of treating pain by administering a sublingually effective dose of buprenorphine with naloxone. U.S. Pat. No. 6,277,384 also discloses a dosage form containing a combination of an opioid agonist and an opioid antagonist in a specific ratio that brings about a negative effect on administration to an addicted person. U.S. Application Publication No. 2004/0241218 discloses a transdermal system which includes an inactivating agent, e.g., a substance which crosslinks the opioid drug, to prevent abuse. Such transdermal formulations may also include an antagonist.
SUMMARY OF THE INVENTION
The present invention provides a bioerodable abuse resistant transmucosal drug delivery device and method of treatment using such devices. The drug delivery devices of the present invention provide reduced illicit abuse potential and are particularly useful in, e.g., opioid transmucosal drug delivery. The transmucosal drug delivery devices of the present invention generally include a drug and its antagonist contained within the device such that abuse of the drug is impeded.
Thus, for example, illicit use efforts to extract an abusable drug from the transmucosal devices of the present invention for parenteral injection (e.g., by extraction of the drug by dissolving some or all of the transmucosal device in water or other solvent), are thwarted by the co-extraction of an antagonist. The amount of antagonist contained in the product is chosen to block any psychopharmacological effects that would be expected from parenteral administration of the drug alone. The antagonist is generally associated with an abuse-resistant matrix, and does not interfere with the transmucosal delivery of the drug.
One of the advantages of the devices of the present invention is that the devices generally include an abuse-resistant matrix that does not effectively release the antagonist when the device is used in a non-abusive manner. The dosage forms described in U.S. Pat. No. 4,582,384 and U.S. Pat. No. 6,227,384, even when correctly administered, release the corresponding antagonist into the mucosa along with the opioid. This impairs the activity of the opioid analgesic and it often becomes necessary to increase the quantity thereof required in the dosage form for satisfactory treatment of the patient. The risk of the occurrence of undesirable accompanying symptoms is also increased in comparison to dosage forms which contain no opioid antagonists. Moreover, it is desirable not to further increase the stress on the patient by releasing a large proportion of opioid antagonist when such a dosage form is correctly administered.
One of the advantages of the devices of the present invention is that the devices are bioerodable, such that the devices do not have to be removed after use.
Accordingly, in one aspect, the present invention includes a bioerodable abuse-resistant drug delivery device. The device generally includes transmucosal drug delivery composition and an abuse-resistant matrix. The transmucosal drug delivery composition includes an abusable drug and the abuse-resistant matrix includes an antagonist to the abusable drug. The delivery device can be, for example, a mucoadhesive drug delivery device, a buccal delivery device, and/or a sublingual delivery device. In some embodiments, the antagonist is substantially transmucosally unavailable. In other embodiments, the device is substantially free of inactivating agents.
In some embodiments, the abuse-resistant matrix is a layer or coating, e.g., a water-erodable coating or layer at least partially disposed about the antagonist. In some embodiments, the abuse-resistant matrix is a water-hydrolysable, water-erodable or water-soluble matrix, e.g., an ion exchange polymer. In some embodiments, the delivery device is in the form of a tablet, a lozenge, a film, a disc, a capsule or a mixture of polymers.
In some embodiments, the device includes a mucoadhesive layer. In some embodiments, the device includes a mucoadhesive layer and a non-adhesive backing layer. In other embodiments, the device includes a third layer disposed between the mucoadhesive layer and the backing layer. In some embodiments, either or both of the abusable drug and the abuse-resistant matrix are incorporated into a mucoadhesive layer. In some embodiments, the abuse-resistant matrix is incorporated into the backing layer. In some embodiments, either or both of the abusable drug and the abuse-resistant matrix are incorporated into the third layer. In some embodiments, the abuse-resistant matrix is the third layer. In some embodiments, either or both of the abusable drug and the abuse-resistant matrix are incorporated into any combination of layers discussed herein. In some embodiments, the abusable drug is incorporated into the mucoadhesive layer and the abuse-resistant matrix is incorporated into the backing layer.
In some embodiments, the abuse-resistant matrix erodes at a slower rate than the backing layer, the mucoadhesive layer, the third layer, or any combination thereof.
In some embodiments, the abusable drug can be, but is not limited to opiates and opioids, e.g., alfentanil, allylprodine, alphaprodine, apomorphine, anileridine, apocodeine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, cyclorphan, cyprenorphine, desomorphine, dextromoramide, dextropropoxyphene, dezocine, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, eptazocine, ethylmorphine, etonitazene, etorphine, fentanyl, fencamfamine, fenethylline, hydrocodone, hydromorphone, hydroxymethylmorphinan, hydroxypethidine, isomethadone, levomethadone, levophenacylmorphan, levorphanol, lofentanil, mazindol, meperidine, metazocine, methadone, methylmorphine, modafinil, morphine, nalbuphene, necomorphine, normethadone, normorphine, opium, oxycodone, oxymorphone, pholcodine, profadol remifentanil, sufentanil, tramadol, corresponding derivatives, physiologically acceptable compounds, salts and bases.
In some embodiments, the antagonist includes, but is not limited to opiate or opioid antagonists, e.g., naloxone, naltrexone, nalmefene, nalide, nalmexone, nalorphine, naluphine, cyclazocine, levallorphan and physiologically acceptable salts and solvates thereof.
In some embodiments, the abuse-resistant matrix includes, but is not limited to, partially crosslinked polyacrylic acid, Polycarbophil™, Providone™, cross-linked sodium carboxymethylcellulose, gelatin, chitosan, Amberlite™ IRP69, Duolite™ AP143, AMBERLITE™ IRP64, AMBERLITE™ IRP88, and combinations thereof. In other embodiments, the abuse-resistant matrix includes, but is not limited to, alginates, polyethylene oxide, poly ethylene glycols, polylactide, polyglycolide, lactide-glycolide copolymers, poly-epsilon-caprolactone, polyorthoesters, polyanhydrides and derivatives, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxyethylmethyl cellulose, hydroxypropylmethyl cellulose, polyacrylic acid, and sodium carboxymethyl cellulose, poly vinyl acetate, poly vinyl alcohols, polyethylene glycol, polyethylene oxide, ethylene oxide-propylene oxide co-polymers, collagen and derivatives, gelatin, albumin, polyaminoacids and derivatives, polyphosphazenes, polysaccharides and derivatives, chitin, or chitosan bioadhesive polymers, polyacrylic acid, polyvinyl pyrrolidone, sodium carboxymethyl cellulose, and combinations thereof.
In some embodiments, the device is less susceptible to abuse than an abusable drug alone. In other embodiments, less than 30% of the efficacy of the abusable drug is retained when used in an abusive manner. In some embodiments, the antagonist and the abusable drug are released at substantially the same rate when abusively dissolved. In some embodiments, the antagonist and the abusable drug are released at substantially the same rate when dissolved in water. In other embodiments, the ratio of released antagonist to released abusable drug is not less than about 1:20.
In some aspects, the present invention provides a method for treating pain in a subject. The method includes administering any device described herein such that pain is treated. In some embodiments, the extent of the absorption into systemic circulation of the antagonist by the subject is less than about 15% by weight. In some embodiments, the dosage of the abusable drug is between about 50 μg and about 10 mg.
In some aspects, the bioerodable abuse-resistant drug delivery device comprising: a layered film having at least one bioerodable, mucoadhesive layer to be placed in contact with a mucosal surface, and at least one bioerodable non-adhesive backing layer, wherein at least one abusable drug is incorporated in at least the mucoadhesive layer, and an abuse-resistant matrix comprising an antagonist to the abusable drug is incorporated in any or all of the layers.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 graphically depicts the measure of positive and negative effects felt by a subject who was administered placebo, fentanyl only, and varying ratios of fentanyl and naloxone.
DETAILED DESCRIPTION OF THE INVENTION
Subjects with pain, e.g., cancer pain, are typically opioid tolerant because of the chronic narcotic use required to control such pain. Moreover, the dose of transmucosal opioid drug, e.g., fentanyl, required to treat breakthrough pain (for example, pain associated with unusual movement) can be high because of the opioid tolerance. In fact, doses in excess of one mg, a dose that would be fatal for a subject that was not opioid tolerant, are often used. This amount of a potent narcotic in a device makes it potentially subject to diversion and abuse by the intended route of administration as well as through extraction of the fentanyl for injection or inhalation.
Abuse by injection can be prevented or reduced by the inclusion of an antagonist, such as naloxone, in the formulation, which would block any psychopharmacologic effect of injected opioid drug.
Accordingly, the present invention relates to novel drug delivery devices that provide for the transmucosal delivery of an abusable drug while reducing, and, in some embodiments, eliminating abuse potential. The drug delivery devices generally include an abusable drug and at least one antagonist for the drug incorporated into a device (e.g., a multilayered transmucosal delivery device) that impedes abuse of the drug. Abuse of the drug can be impeded by use of the present invention in many, non-limiting ways. In some embodiments, the antagonist impedes abuse of the drug because attempts to extract the drug from the transmucosal delivery device results in co-extraction of the antagonist which blocks the expected effect of the drug. In other embodiments, the abusable drug and the antagonist are incorporated into the same layer or indistinguishable layers of a delivery device of the present invention, so that they can not be separated from one another, e.g., by peeling one layer off of the device.
When used as intended, however, the abusable drug will be delivered through the mucosa, e.g., by application to the mucous membrane of the mouth, and thus into the systemic circulation. The antagonist is associated with an abuse-resistant matrix, e.g., dispersed within coated-microparticles or chemically-bound to a polymer that impedes or prevents mucoabsorption, e.g., a high molecular weight polymer or an ion exchange polymer. In some embodiments, the antagonist is substantially transmucosally unavailable when used in a non-abusive manner. Without wishing to be bound by any particular theory, it is believed that when used in a non-abusive manner, the opioid antagonist will be swallowed, e.g., as an unbound antagonist in a layer or matrix not contacting the mucosa and/or as an intact microcapsule, polymer bound particle or in some other form not amenable to mucosal administration. Because the opioid antagonist is poorly absorbed from the gastrointestinal tract, the amount in the systemic circulation is below a level that would produce a significant pharmacologic effect against the drug, and therefore it is relatively inactive under these conditions.
In order to more clearly and concisely describe the subject matter of the claims, the following definitions are intended to provide guidance as to the meaning of terms used herein.
The terms “abusable drug” or “drug” as used interchangeably herein, refers to any pharmaceutically active substance or agent that has the ability to promote abuse, high tolerance with extended use, and/or chemical or physical dependency. Abusable drugs include, but are not limited to, drugs for the treatment of pain such as an opioid analgesic, e.g., and opioid or an opiate.
As used herein, the term “antagonist” refers to a moiety that renders the active agent unavailable to produce a pharmacological effect, inhibits the function of an agonist, e.g., an abusable drug, at a specific receptor, or produces an adverse pharmacological effect. For example, in some embodiments, when used in an abusive manner, the antagonist is released in an amount effective to attenuate a side effect of said opioid agonist or to produce adverse effect such as anti-analgesia, hyperalgesia, hyperexcitability, physical dependence, tolerance, or any combination thereof. Without wishing to be bound by any particular theory, it is believed that antagonists generally do not alter the chemical structure of the abusable drug itself, but rather work, at least in part, by an effect on the subject, e.g., by binding to receptors and hindering the effect of the agonist. Antagonists can compete with an agonist for a specific binding site (competitive antagonists) and/or can bind to a different binding site from the agonist, hindering the effect of the agonist via the other binding site (non-competitive antagonists). Non-limiting examples of antagonists include opioid-neutralizing antibodies; narcotic antagonists such as naloxone, naltrexone and nalmefene; dysphoric or irritating agents such as scopolamine, ketamine, atropine or mustard oils; or any combinations thereof. In one embodiment, the antagonist is naloxone or naltrexone.
The term “bioerodable” as used herein refers to the property of the devices of the present invention which allow the solid or semisolid portion of the device to sufficiently degrade by surface erosion, bioerosion, and/or bulk degradation such that it is small enough to be swallowed. Bulk degradation is the process in which a material, e.g., a polymer, degrades in a fairly uniform manner throughout the matrix. This results in a reduction of molecular weight (Mn) without immediate change in physical properties, followed by fragmentation due to faster penetration of saliva or water into the device than conversion of the device into saliva- or water-soluble form. Bioerosion or surface erosion generally occurs when the rate at which saliva or water penetrates the material is slower than the rate of the conversion of the material into saliva- or water-soluble substances. Bioerosion generally results in a thinning of the material over time, though the bulk integrity is maintained. It is to be understood that “bioerodable” refers to the device as a whole, and not necessarily to its individual components. For example, if the antagonist is microencapsulated or coated, the microcapsules or coating may or may not be bioerodable, but the device as a whole may be bioerodable such that as the device is eroded the intact microcapsules or coated antagonist is swallowed. This can be advantageous because the device will erode and the microcapsules or coated antagonist can be delivered to the GI tract intact, i.e., without crossing the mucosa. The term “bioerodable” is intended to encompass many modes of material removal, such as enzymatic and non-enzymatic hydrolysis, oxidation, enzymatically-assisted oxidation, wear, degradation and/or dissolution.
Bioerodable materials are generally selected on the basis of their degradation characteristics to provide a sufficient functional lifespan for the particular application. In the case of applications of the present invention, a functional lifespan of between 1 minute and 10 hours may be suitable. In some embodiments, the functional lifespan is about 2 minutes. In some embodiments, the functional lifespan is about 5 minutes. In some embodiments, the functional lifespan is about 10 minutes. In some embodiments, the functional lifespan is about 15 minutes. In some embodiments, the functional lifespan is about 20 minutes. In some embodiments, the functional lifespan is about 30 minutes. In some embodiments, the functional lifespan is about 45 minutes. In some embodiments, the functional lifespan is about 60 minutes. In some embodiments, the functional lifespan is about 2 hours. In some embodiments, the functional lifespan is about 3 hours. In some embodiments, the functional lifespan is about 4 hours. In some embodiments, the functional lifespan is about 5 hours. In some embodiments, the functional lifespan is about 10 hours. All ranges and values which fall between the ranges and values listed herein are meant to be encompassed by the present invention. For example, lifespans of between about 5 minutes and about 45 minutes, between about 6 minutes and about 53 minutes, between about 13 minutes and about 26 minutes, etc. are all encompassed herein. Shorter or longer periods may also be appropriate.
Bioerodable materials include, but are not limited to, polymers, copolymers and blends of polyanhydrides (e.g., those made using melt condensation, solution polymerization, or with the use of coupling agents, aromatic acids, aliphatic diacids, amino acids, e.g., aspartic acid and glutamic acid, and copolymers thereof); copolymers of epoxy terminated polymers with acid anhydrides; polyorthoesters; homo- and copolymers of α-hydroxy acids including lactic acid, glycolic acid, ε-caprolactone, γ-butyrolactone, and δ-valerolactone; homo- and copolymers of α-hydroxy alkanoates; polyphosphazenes; polyoxyalkylenes, e.g., where alkene is 1 to 4 carbons, as homopolymers and copolymers including graft copolymers; poly(amino acids), including pseudo poly(amino acids); polydioxanones; and copolymers of polyethylene glycol with any of the above.
As used herein, the articles “a” and “an” mean “one or more” or “at least one,” unless otherwise indicated. That is, reference to any element of the present invention by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present.
The term “abuse-resistant matrix” refers generally to a matrix with which an antagonist to an abusable drug is associated. An abuse resistant matrix is a matrix that effectively releases the antagonist when the device is used in an abusive manner (e.g., dissolved in water in an attempt to extract the drug, solubilized, opened, chewed and/or cut apart) so that, e.g., the antagonist is co-extracted and alters or blocks the effect the drug. However, when used as intended, e.g., in a non-abusive manner, the abuse-resistant matrix does not effectively release the antagonist. E.g., the antagonist instead is retained within the matrix and is delivered to the gastrointestinal tract where it is not readily absorbed such that any amount of antagonist delivered systemically through the mucosa and/or the GI tract does not significantly block or alter the effect of the drug.
When used in reference to the antagonist, the phrase “substantially transmucosally unavailable” refers to the fact that the antagonist in the compositions and devices of the present invention is available transmucosally in amounts that do not effect, or negligibly effect, the efficacy of the abusable drug when employed in a non-abusive manner. Without wishing to be bound by any particular theory, it is believed that the antagonist is prevented or slowed from entering the system transmucosally while still being available for other routes of administration (e.g., swallowing or dissolution), thus allowing the abusable drug to act efficaciously in a transmucosal composition, but hindering the use of the composition in an abusive manner. That is, it is to be understood that the antagonist effects the efficacy of the abusable drug when the compositions of the present invention are abused. In non-abusive situations, the antagonist provides no or negligible effect, e.g., is swallowed. In some embodiments, less than about 25% antagonist (by weight versus abusable drug) can be delivered non-abusively, e.g., transmucosally. In other embodiments, less than about 15% antagonist is delivered transmucosally. In still other embodiments, less than 5% of antagonist is delivered transmucosally. In some embodiments, less than 2% antagonist is delivered transmucosally. In still other embodiments, less than 1% antagonist is delivered transmucosally.
Accordingly, in some embodiments, when the device is a multilayer disc or film, the abuse-resistant matrix is a layer or is incorporated into a layer which is disposed between a mucoadhesive layer and a backing layer. In other embodiments, the abuse-resistant matrix is incorporated into a backing layer. Without wishing to be bound by any particular theory, it is believed that the antagonist would not able to enter systemic circulation through the mucosa in any significant amount because it would be washed into the GI tract, e.g., swallowed. In some embodiments, the abuse resistant matrix is a coating or water-hydrolysable matrix, e.g., an ion-exchange polymer. The coating or water-hydrolysable matrix can be chosen such that it dissolves more slowly than a backing layer as described above. The coating or water-hydrolysable matrix can additionally or alternatively be chosen such that they dissolve slowly enough not to release the antagonist at all. Without limiting the invention, it is believed that the antagonist would be washed into the GI tract as either free-antagonist or as a coated or otherwise entrapped, e.g., by the ion-exchange polymer, moiety. It is to be understood that layers, coatings, and water-hydrolyzable matrices are exemplary, and that additional abuse-resistant matrices can be envisioned using the teachings of the present invention.
As used herein, the term “abusive manner” refers to the use of the delivery device in a manner not intended, e.g., in a non-transmucosal manner or in a manner not otherwise prescribed by a physician. In some embodiments, the abusive manner includes extraction of the drug from the delivery device for oral or parenteral administration. As used herein, “non-abusive manner” refers to the use of the delivery device for its intended purpose, e.g., transmucosal administration of the drug. In some cases, a portion of the drug will unintentionally be delivered non-transmucosally, e.g., orally through the dissolution of a portion of the device. Such inadvertent or unintentional delivery is not indicative of use in an abusive manner.
Accordingly, in some embodiments, the devices of the present invention are less susceptible to abuse than an abusable drug alone. For example, when used in an abusive manner, the abusable drug may only retain about 50%, 40%, 30%, 20%, 10%, 5%, 2%, 1% or 0% of its efficacy, e.g., as a pain reliever. Accordingly, when used in an abusive manner, it is believed that the effectiveness of the abusable drug, e.g., the ability to produce a “high” in an addict, would be reduced by a corresponding amount, e.g., by 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 100%.
As used herein, “treatment” of a subject includes the administration of a drug to a subject with the purpose of preventing, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder (e.g., to alleviate pain).
The term “subject” refers to living organisms such as humans, dogs, cats, and other mammals. Administration of the drugs included in the devices of the present invention can be carried out at dosages and for periods of time effective for treatment of a subject. An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. Similarly, effective amounts of antagonist to a drug will vary according to such factors such as the amount of drug included in the devices.
In some embodiments, the antagonist and the abusable drug are incorporated into a delivery device such as the devices described in U.S. Pat. No. 5,800,832 and/or U.S. Pat. No. 6,585,997, the entireties of which are incorporated herein by this reference. In other embodiments, the antagonist and the abusable drug are incorporated into a delivery device that is dissimilar to the devices described in U.S. Pat. No. 5,800,832 and/or U.S. Pat. No. 6,585,997. It is to be understood that any transmucosal drug delivery device can be used with the teachings of the present invention to provide an abuse-resistant device of the present invention.
In some embodiments, the antagonist and the abusable drug are incorporated into a narcotic drug product. In other embodiments, the antagonist and the abusable drug are incorporated into an antagonist drug product. In one embodiment, the antagonist drug product is a naloxone drug product.
In some embodiments, the antagonist and the abusable drug are incorporated into a delivery device such as the devices described in U.S. Pat. No. 6,200,604 (incorporated herein in its entirety by this reference) and/or U.S. Pat. No. 6,759,059 (incorporated herein in its entirety by this reference). In other embodiments, the antagonist and the abusable drug can be combined in a sublingual or buccal monolayer or multilayer tablets. In some embodiments, the antagonist and the abusable drug are incorporated into a mucoadhesive liquid and/or a mucoadhesive solid formulation. It is to be understood that any sublingual tablet, buccal tablet, mucoadhesive liquid formulation and/or mucoadhesive solid formulation can be used with the teachings of the present invention to provide an abuse-resistant device of the present invention.
In some embodiments, the antagonist and the abusable drug are incorporated into a delivery device such as a transdermal drug device, for example, a transdermal patch. In some embodiments, the transdermal drug device is a transdermal analgesic drug device. It is to be understood that any transdermal drug device can be used with the teachings of the present invention to provide an abuse-resistant device of the present invention.
In some embodiments, the abuse-resistant drug delivery device is in the form of a disc, patch, tablet, solid solution, lozenge, liquid, aerosol or spray or any other form suitable for transmucosal delivery.
As used herein, the term “incorporated” as used with respect to incorporation of a drug and/or an antagonist into the devices of the present invention or any layer of the devices of the present invention, refers to the drug or antagonist being disposed within, associated with, mixed with, or otherwise part of a transmucosal device, e.g., within one or more layers of a multilayered device or existing as a layer or coating of the device. It is to be understood that the mixture, association or combination need not be regular or homogeneous.
In some embodiments, the delivery devices of the present invention are substantially free of inactivating agents. As used herein, the term “inactivating agent” refers to a compound that inactivates or crosslinks the abusable drug, in order to decrease the abuse potential of the dosage form. Examples of inactivating agents include polymerizing agents, photoinitiators, and formalin. Examples of polymerizing agents include diisocyanates, peroxides, diimides, diols, triols, epoxides, cyanoacrylates, and UV activated monomers.
Accordingly, in some embodiments, the present invention is directed to devices and methods for treating pain in a subject, e.g., a human, with a dosage of an abusable drug while reducing the abuse potential. The methods can employ any of the devices enumerated herein with any of the desired release profiles herein, e.g., absorption of less than 10% of the antagonist through the mucosa into systemic circulation.
In the present invention, a novel device is employed for application to mucosal surfaces to provide transmucosal delivery of an abusable drug, e.g., an opioid analgesic into the systemic circulation providing rapid onset with minimal discomfort and ease of use. Accordingly, in one aspect, the devices of the present invention include an abusable drug and an antagonist to the abusable drug associated with an abuse-resistant matrix. The delivery device can be a mucoadhesive drug delivery device, a buccal delivery device, and/or a sublingual delivery device.
The devices of the present invention may include any number of layers, including but not limited to mucoadhesive layers, non-adhesive layers, backing layers and any combination thereof. In some embodiments, the device includes a mucoadhesive layer. In some embodiments, the device includes a mucoadhesive layer and a non-adhesive backing layer. In other embodiments, the device includes a third layer disposed between the mucoadhesive layer and the backing layer. In some embodiments, either or both of the abusable drug and the abuse-resistant matrix are incorporated into a mucoadhesive layer. In some embodiments, the abuse-resistant matrix is incorporated into the backing layer. In some embodiments, either or both of the abusable drug and the abuse-resistant matrix are incorporated into the third layer. In some embodiments, the abuse-resistant matrix is the third layer. Furthermore, where the device contains a third layer between the mucoadhesive layer and the backing layer, this third layer can be indistinguishable from the mucoadhesive layer. Such an embodiment can be useful because it prevents the removal of layers from the device in an effort to extract the drug. The third layer may also be co-extractable with the abusable drug. In some embodiments, the third layer is a non-adhesive layer. In some embodiments, either or both of the abusable drug and the abuse-resistant matrix are incorporated into any combination of layers discussed herein. Any or all of the layers of the transmucosal delivery device can be water-soluble.
In some embodiments, the antagonist is incorporated in the backing layer. This embodiment can be employed to allow the antagonist to release quickly in a situation when one may try to abuse the product. In this embodiment, the antagonist would be substantially swallowed upon erosion of the backing layer such that there is minimum transmucosal adsorption of the antagonist. In another embodiment, the antagonist is incorporated into a layer which is disposed between the adhesive drug layer and the backing layer. This allows delayed or sustained release of the antagonist. By separating the antagonist and the drug in separate indistinguishable layers, the antagonist does not interfere with the transmucosal delivery of the drug. In yet another embodiment, the antagonist may be commingled with the drug in the mucoadhesive layer. This aspect allow the drug and the antagonist to be physically in the same layer thus providing superior abuse resistance, in that the drug and the antagonist will be inseparable when used in an abusive manner.
In some embodiments, the abusable drug is included in a mucoadhesive layer, generally closest to the treatment site, and the backing layer protects the mucoadhesive layer from contact with saliva or other fluid resulting in slower dissolution of the mucoadhesive layer and longer contact of the mucoadhesive layer and drug with the treatment site. In such embodiments, the placement of the abusable drug in the mucoadhesive layer allows the abusable pharmaceutically active substance to unidirectionally diffuse through the buccal mucosa of the mouth and into the systemic circulation, while avoiding first pass metabolism by the liver.
The mucoadhesive layer, e.g., a bioerodible mucoadhesive layer, is generally comprised of water-soluble polymers which include, but are not limited to, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethylmethyl cellulose, polyacrylic acid (PAA) which may or may not be partially crosslinked, sodium carboxymethyl cellulose (NaCMC), and polyvinylpyrrolidone (PVP), or combinations thereof. Other mucoadhesive water-soluble polymers may also be used in the present invention.
The backing layer, e.g., a bioerodible non-adhesive backing layer, is generally comprised of water-soluble, film-forming pharmaceutically acceptable polymers which include, but are not limited to, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethylmethyl cellulose, polyvinylalcohol, polyethylene glycol, polyethylene oxide, ethylene oxide-propylene oxide co-polymers, or combinations thereof. The backing layer may comprise other water-soluble, film-forming polymers as known in the art. Exemplary mucoadhesive and non-adhesive layers, including polymers suitable for such layers are also described, e.g., in U.S. Pat. Nos. 5,800,832 and 6,159,498, the entireties of which are incorporated by this reference.
The devices of the present invention can provide, when desired, a longer residence time than those devices known in the art. In some embodiments, this is a result of the selection of the appropriate backing layer formulation, providing a slower rate of erosion of the backing layer. Thus, the non-adhesive backing layer is further modified to render controlled erodibility which can be accomplished by coating the backing layer film with a more hydrophobic polymer selected from a group of FDA approved Eudragit™ polymers, ethyl cellulose, cellulose acetate phthalate, and hydroxyl propyl methyl cellulose phthalate, that are approved for use in other pharmaceutical dosage forms. Other hydrophobic polymers may be used, alone or in combination with other hydrophobic or hydrophilic polymers, provided that the layer derived from these polymers or combination of polymers erodes in a moist environment. Dissolution characteristics may be adjusted to modify the residence time and the release profile of a drug when included in the backing layer.
In some embodiments, any of the layers in the devices of the present invention may also contain a plasticizing agent, such as propylene glycol, polyethylene glycol, or glycerin in a small amount, 0 to 15% by weight, in order to improve the “flexibility” of this layer in the mouth and to adjust the erosion rate of the device. In addition, humectants such as hyaluronic acid, glycolic acid, and other alpha hydroxyl acids can also be added to improve the “softness” and “feel” of the device. Finally, colors and opacifiers may be added to help distinguish the resulting non-adhesive backing layer from the mucoadhesive layer. Some opacifers include titanium dioxide, zinc oxide, zirconium silicate, etc.
The device according to the invention may comprise one or more opioid analgesics with potential for abuse and one or more antagonists. However, in some embodiments, the device according to the invention comprises only one active opioid analgesic and only one antagonist for this active opioid analgesic.
The abusable drug, e.g., an opioid analgesic, agonist, or partial agonist according to the invention, include, but are not limited to, alfentanil, allylprodine, alphaprodine, apomorphine, anileridine, apocodeine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, cyclorphan, cyprenorphine, desomorphine, dextromoramide, dextropropoxyphene, dezocine, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, eptazocine, ethylmorphine, etonitazene, etorphine, fentanyl, fencamfamine, fenethylline, hydrocodone, hydromorphone, hydroxymethylmorphinan, hydroxypethidine, isomethadone, levomethadone, levophenacylmorphan, levorphanol, lofentanil, mazindol, meperidine, metazocine, methadone, methylmorphine, modafinil, morphine, nalbuphene, necomorphine, normethadone, normorphine, opium, oxycodone, oxymorphone, pholcodine, profadol remifentanil, sufentanil, tramadol, and corresponding derivatives, and/or their physiologically acceptable compounds, in particular salts and bases, stereoisomers thereof, ethers and esters thereof, and mixtures thereof.
Pharmaceutically acceptable salts include inorganic salts and organic salts, e.g., hydrobromides, hydrochlorides, mucates, succinates, n-oxides, sulfates, malonates, acetates, phosphate dibasics, phosphate monobasics, acetate trihydrates, bi(heplafluorobutyrates), maleates, bi(methylcarbamates), bi(pentafluoropropionates), mesylates, bi(pyridine-3-carboxylates), bi(trifluoroacetates), hemitartrates, (bi)tartrates, chlorhydrates, fumarates and/or sulfate pentahydrates.
In some embodiments, the present invention includes devices having at least one opioid analgesic in a dosage range of about 1 μg to about 50 mg. In some embodiments, the present invention includes devices having at least one opioid analgesic in a dosage range of about 10 μg to about 25 mg. In still other embodiments, the devices of the present invention have at least one opioid analgesic in a dosage range of about 50 μg to about 10 mg. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
The amount of abusable drug to be used depends on the desired treatment strength, although preferably, the abusable drug comprises between about 0.001 and about 30% by weight of the device. It is to be understood that all values and ranges between the listed values and ranges are to be encompassed by the present invention.
The antagonist to the abusable drug can be an opioid antagonist. Opioid antagonists are known to those skilled in the art and are known to exist in various forms, e.g., as salts, bases, derivatives, or other corresponding physiologically acceptable forms. The opioid antagonists can be, but are not limited to, antagonists selected from the group consisting of naloxone, naltrexone, nalmefene, nalide, nalmexone, nalorphine, naluphine, cyclazocine, levallorphan and/or their physiologically acceptable salts, bases, stereoisomers, ethers and esters thereof and mixtures thereof.
In some embodiments, the devices of the present invention include an opioid antagonist in a dosage range of about 1 μg to about 20 mg. In some embodiments, the devices of the present invention include an opioid antagonist in a dosage range of about 1.0 μg to about 20 mg. In still other embodiments, the devices of the present invention include an opioid antagonist in a dosage range of about 10 μg and about 10 mg. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention. In some embodiments, the amount of antagonist used is such that the likelihood of abuse of the abusable drug is lessened and/or reduced without diminishing the effectiveness of the abusable drug as a pharmaceutical.
In some embodiments, the antagonist is absorbed into systemic circulation through the mucosa only to a certain desired extent. For example, in some embodiments, the extent of absorption of the antagonist is less than about 15%. In some embodiments, the extent of absorption of the antagonist is less than about 10%. In some embodiments, the extent of absorption of the antagonist is less than about 5%, 4%, 3%, 2% or 1%.
The amount of antagonist which is useful to achieve the desired result can be determined at least in part, for example, through the use of “surrogate” tests, such as a VAS scale (where the subject grades his/her perception of the effect of the dosage form) and/or via a measurement such as pupil size (measured by pupillometry). Such measurements allow one skilled in the art to determine the dose of antagonist relative to the dose of agonist which causes a diminution in the opiate effects of the agonist. Subsequently, one skilled in the art can determine the level of opioid antagonist that causes aversive effects in physically dependent subjects as well as the level of opioid antagonist that minimizes “liking scores” or opioid reinforcing properties in non-physically dependent addicts. Once these levels of antagonist are determined, it is then possible to determine the range of antagonist dosages at or below this level which would be useful in achieving the desired results.
The antagonist is associated with an abuse-resistant matrix. The abuse-resistant matrix can be, but is not limited to a layer or coating, e.g., a water-erodable coating or a water-hydrolysable matrix, e.g., an ion exchange polymer, or any combination thereof. Thus, in one embodiment of the invention, the antagonist is associated with the matrix in a manner such that it is not released in the mouth. In another embodiment of the invention, the antagonist is adequately taste masked. The entrapment and/or taste masking may be achieved by physical entrapment by methods, such as microencapsulation, or by chemical binding methods, e.g., by the use of a polymer that prevents or inhibits mucoabsorption of the antagonist, e.g., ion exchange polymers. Without wishing to be bound by any particular theory, it is believed that the optimum formulation for the particular antagonist may be determined by understanding the ratios needed to prevent abuse, evaluating the possible binding mechanism, and evaluating the physico-chemical properties of the antagonists.
In some embodiments, the antagonist is microencapsulated in an enteric polymer, polysaccharide, starch or polyacrylate. Without wishing to be bound by a particular theory, it is believed that microencapsulation will substantially prevent transmucosal absorption of the antagonist, and allow the subject to swallow the microencapsulated antagonist. The coating of the microcapsules can be designed to offer delayed release characteristics, but will release when the article or composition are placed in an aqueous environment, such as when the dosage form is chewed or subject to extraction. Delayed release can be accomplished, for example, by the use of starches or pH dependent hydrolysis polymers as coating materials for the microencapsulated antagonist. Starches, for example, would be susceptible to any enzymes that are present in the saliva, such as salivary amylase.
In some embodiments, the antagonist is microencapsulated in a microcapsule or microsphere and then incorporated in the abuse resistant matrix. Such a microcapsule or microsphere containing antagonist may be comprised of polymers such as polyacrylates, polysaccharides, starch beads, polyactate beads, or liposomes. In a further embodiment, the microspheres and microcapsules are designed to release in specific parts of the small intestine.
In another embodiment, the devices of the present invention include the antagonist in a micromatrix with complexing polymers such that the micromatrix is incorporated in the abuse resistant matrix. In yet another embodiment, the antagonist is incorporated in a slowly hydrolysable or slowly eroding polymer which is then incorporated in the abuse resistant matrix.
In some embodiments, the opioid resides in the mucoadhesive layer, which is in contact with the mucosa, while the antagonist resides in the backing layer, which is non-adhesive and erodes over time. When present, a layer disposed between the mucoadhesive layer and the backing layer may also include an antagonist. This may provide a lower driving force for the antagonist absorption in the transmucosal space, while still being swallowed upon release. The antagonist will also be released promptly from the layer disposed between the mucoadhesive layer and the backing layer, thus hindering abuse.
In one embodiment, the abuse-resistant matrix comprises water soluble polymers, e.g., polymers similar to those described for the mucoadhesive and/or backing layers, but is associated with the device such that the antagonist is not mucosally absorbed to a significant extent. For example, the matrix can be a third layer disposed between a mucoadhesive layer and a backing layer.
In one embodiment of an exemplary layered device, the drug can be placed in the mucoadhesive layer along with an antagonist which is chemically bound to a polymer, e.g., pharmaceutically acceptable ion-exchange polymer and/or which is physically entrapped in a microcapsule within a water soluble polymer coating. Upon extraction in water, both the drug and the antagonist are extracted simultaneously, eliminating the abuse potential of the extracted drug. In some embodiments, the chemical bond between the polymer, e.g., the ion-exchange polymer, and the antagonist is also hydrolysable.
In an exemplary three layered device configuration, the drug can be placed in the mucoadhesive layer, while the antagonist is placed in an indistinguishable, sandwiched third layer either in a physically or chemically bound state as described herein. Again, upon extraction in water, both the drug and its antagonist are extracted reducing or eliminating the abuse potential of the extracted drug.
In some embodiments, the abuse-resistant matrix is a water-hydrolysable matrix. The term “water-hydrolysable matrix” as used herein, refers to a controlled release matrix that allows water hydrolysis of the matrix at a desired rate, thus also effecting release of the material within the matrix at the desired rate. In some embodiments, the water-hydrolysable matrix is an ion-exchange polymer. In some embodiments, the water-hydrolysable matrix, e.g., the ion-exchange polymer is chosen such that it erodes at a rate slower than the erosion rate of the mucoadhesive layer. In other embodiments, the water-hydrolysable matrix is chosen such that it erode at a rate slower than the erosion rate of the mucoadhesive layer but quicker than the erosion rate of the non-adhesive backing layer. In some embodiments, the rate of dissociation of the antagonist from the ion-exchange polymer is slower than the rate of erosion of the layer in which it is incorporated.
In some embodiments, chemical binding of the antagonist by ion exchange polymers can also facilitate taste masking and will delay the release of the antagonist allowing the antagonist to be swallowed. Under triggered ionic change induced by ionic molecules (e.g., defined by the Hofmeister's series) or a shift in pH, the drug can be hydrolyzed from the ionic polymer.
In some embodiments, the abuse-resistant matrix includes materials used for chemical binding, e.g., in ion-exchange polymers. Such materials include, but are not limited to, polyanhydrides, poly(hydroxyethyl methacrylate), polyacrylic acid, sodium acrylate, sodium carboxymethyl cellulose, poly vinyl acetate, poly vinyl alcohols, poly(ethylene oxide), ethylene oxide-propylene oxide co-polymers, poly(N-vinyl pyrrolidone), poly(methyl methacrylate), polyacrylamide, poly(ethylene-co-vinyl acetate), poly(ethylene glycol), poly(methacrylic acid), gelatin, chitosan, collagen and derivatives, albumin, polyaminoacids and derivatives, polyphosphazenes, polysaccharides and derivatives and commercial polymers such as, but not limited to, noveon AA1 POLYCARBOPHIL™, PROVIDONE™, AMBERLITE™ IRP69, DUOLITE™ AP143, AMBERLITE™ IRP64, and AMBERLITE™ IRP88, and any combinations thereof. A cationic polymer such as AMBERLITE™ IR-122 or an anion exchange resin such as AMBERLITE™ IRA-900 may also be used, depending upon the pKa of the drug. Functional groups may include, but are not limited to R—CH2N+(CH3)3, R—CH2N+(CH3)2C2H4OH, R—SO3—, R—CH2N+H(CH3)2, R—CH2COO—, R—COO—, and R—CH2N(CH2COO)2.
The selection of the ion exchange polymer depends on the pKa of the antagonist, and functional groups attached to the drug moiety such as —COOH, —OH or amine functionalities on its backbone which could be used to bind to an ion exchange polymer. The amount of the drug loaded on to the ion exchange polymer depends on the molecular weight of the opioid antagonist, the type of ion exchange polymer used, and its ionic stoichiometric ratio. In some embodiments, the antagonist to ion exchange polymer ratios range from about 1:99 to about 99:1. In other embodiments, the antagonist to ion exchange polymer ratios range from about 1:9 to about 9:1. In other embodiments, the antagonist to ion exchange polymer ratios range from about 1:3 to about 3:1.
In some embodiments, the abuse-resistant matrix is a layer coating, e.g., a water-erodable coating. That is, physical entrapment of the antagonist in the device, e.g., the mucoadhesive layer, can be facilitated by a barrier layer which is coated with a water soluble polymer which erodes slowly. That is, antagonists may be at least partially coated or disposed within water-erodable coating. Methods of microencapsulation and particle coating have been defined in the literature.
In some embodiments, the abuse-resistant matrix includes materials used for physical entrapment. Such materials include, but are not limited to, alginates, polyethylene oxide, poly ethylene glycols, polylactide, polyglycolide, lactide-glycolide copolymers, poly-epsilon-caprolactone, polyorthoesters, polyanhydrides and derivatives, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxyethylmethyl cellulose, hydroxypropylmethyl cellulose, polyacrylic acid, and sodium carboxymethyl cellulose, poly vinyl acetate, poly vinyl alcohols, polyethylene glycol, polyethylene oxide, ethylene oxide-propylene oxide co-polymers, collagen and derivatives, gelatin, albumin, polyaminoacids and derivatives, polyphosphazenes, polysaccharides and derivatives, chitin, chitosan bioadhesive polymers, polyacrylic acid, polyvinyl pyrrolidone, sodium carboxymethyl cellulose and combinations thereof.
Other exemplary water-erodable coatings and water-hydrolysable matrices are known in the art, e.g., in U.S. Pat. Nos. 6,228,863 and 5,324,351.
In some embodiments, the device provides an appropriate residence time for effective opioid analgesic delivery at the treatment site, given the control of solubilization in aqueous solution or bodily fluids such as saliva, and the slow, natural dissolution of the film concomitant to the delivery. The residence time can also be tailored to provide a range from minutes to hours, dependent upon the type of opioid used and therapeutic indication. In some embodiments, residence times of between about 20 to 30 minutes and about 3 to 4 hours are achieved with the devices of the present invention. In other embodiments, residence times of between about 1 hour and about 2 hours are achieved. The residence time of the device of the present invention depends on the dissolution rate of the water-soluble polymers used. The dissolution rate may be adjusted by mixing together chemically different hydrophilic and hydrophobic polymers or by using different molecular weight grades of the same polymer. Such adjustments are well described in the art of controlled release.
As the materials used in the devices of the present invention are soluble in water, illicit use efforts to extract the opioid from the adhesive layer for parenteral injection, are thwarted by the co-extraction of the opioid antagonist. The amount of opioid antagonist contained in the product is designed to block any psychopharmacological effects that would be expected from parenteral administration of the opioid alone.
In some embodiments, upon use of the device in an abusive manner, the antagonist is generally released (e.g., dissolved in water or some other appropriate solvent) at substantially the same rate as the abusable drug. For example, in some embodiments, the antagonist to the abusable drug is released at substantially the same time as the opioid when abusively dissolved. As used herein, the term “abusively dissolved” refers to dissolution in a solvent other than saliva, for example, water, ethanol or the like. In other embodiments, the antagonist is released at a slower rate as the abusable drug when abusively dissolved. In such cases, the amount of antagonist released would be sufficient to hinder the use of the abusable drug, e.g., by producing unwanted side effects. In some embodiments, the released antagonist to opioid ratio is not less than 1:20. In other embodiments, the released antagonist to opioid ratio is not less than 1:10. In still other embodiments, the released antagonist to opioid ratio is not less than 1:5. In yet other embodiments, the released antagonist to opioid ratio is at least about 1:10. In yet other embodiments, the released antagonist to opioid ratio is at least about 1:20. In yet other embodiments, the released antagonist to opioid ratio is at least about 1:50. Any values and ranges between the listed values are intended to be encompassed by the present invention.
If desired, flavoring agents known in the art may be added to mask the taste of the active compound. Penetration enhancers may also be included in the adhesive layer to help reduce the resistance of the mucosa to drug transport. Typical enhancers known in the art include ethylenediamine tetracetic acid, chitosan, etc. Ingredients to enhance drug solubility and/or stability of the drug may also be added to the layer or layers containing the abusable drug. Examples of stabilizing and solubilizing agents are cyclodextrins.
In some embodiments, the devices and methods of the present invention further include one or more drugs in addition to the abusable drug and antagonist. In some embodiments, a combination of two abusable drugs may be included in the formulation. Two such drugs may, e.g., have different properties, such as half-life, solubility, potency, etc. Additional drugs can provide additional analgesia, and include, but are not limited to, aspirin; acetaminophen; non-sterioidal antiinflammatory drugs (“NSAIDS”), N-methyl-D-aspartate receptor antagonists, cycooxygenase-II inhibitors and/or glycine receptor antagonists. Such additional drugs may or may not act synergistically with the opioid analgesic. Further drugs include antiallergic compounds, antianginal agents, anti-inflammatory analgesic agents, steroidal anti-inflammatory agents, antihistamines, local anesthetics, bactericides and disinfectants, vasoconstrictors, hemostatics, chemotherapeutic drugs, antibiotics, keratolytics, cauterizing agents, hormones, growth hormones, growth hormone inhibitors, analgesic narcotics and antiviral drugs.
In one aspect, the present invention includes methods for treating pain in a subject. The method can include administering any of the devices described herein such that pain is treated.
The pharmaceutical delivery device of the present invention may be prepared by various methods known in the art. For example, in one embodiment, the components are dissolved in the appropriate solvent or combination of solvents to prepare a solution. Solvents for use in the present invention may comprise water, methanol, ethanol, or lower alkyl alcohols such as isopropyl alcohol, acetone, ethyl acetate, tetrahydrofuran, dimethyl sulfoxide, or dichloromethane, or any combination thereof. The residual solvent content in the dried, multilayered film may act as a plasticizer, an erosion- or dissolution-rate-modifying agent or may provide some pharmaceutical benefit. Desired residual solvent may reside in either or both layers.
Each solution is then coated onto a substrate. Each solution is cast and processed into a thin film by techniques known in the art, such as film coating, film casting, spin coating, or spraying using the appropriate substrate. The thin film is then dried. The drying step can be accomplished in any type of oven. However, the solvent residual depends on the drying procedure. The film layers may be filmed independently and then laminated together or may be filmed one on the top of the other. The film obtained after the layers have been laminated together or coated on top of each other may be cut into any type of shape, for application to the mucosal tissue. Some shapes include disks, ellipses, squares, rectangles, and parallepipedes.
EXEMPLIFICATION
Example 1
Effect of Naloxone on Efficacy of Fentanyl
The purpose of this study is to determine the dose range over which IV naloxone administered in combination with IV fentanyl, would precipitate opioid withdrawal signs and symptoms and attenuate any pleasurable effects from intravenous injection in subjects with a moderate level of opioid dependence. It is believed that the addition of this ratio of naloxone to a transmucosal formulation of fentanyl would hinder or prevent abuse.
The trial was a randomized, double-blind, placebo controlled, within-subject crossover study in opioid-dependent volunteers. Subjects were maintained on methadone prior to inpatient admission and throughout the 9-day study period. Subjects received each of the 5 study doses and evaluated the psychopharmacologic effects of each.
The subjects included males or non-pregnant and non-lactating females; 18 to 55 years of age; free from any significant clinical abnormalities on the basis of medical history and physical examination, ECG, and screening laboratory tests; weighing at least 50 kg (110 lbs); with an opioid positive urine sample (>300 ng/ml) and an alcohol-free breath sample (<0.002%).
Subjects were not eligible for the study if they exhibited certain indications or illnesses. For example, subjects with certain psychiatric illness, neurological disease, cardiovascular disease, pulmonary disease, systemic disease, were ineligible. Additionally, subjects with alcohol or sedative abuse and/or dependence, subjects who were cognitively impaired, subjects concurrently being treated for opioid dependence with methadone, buprenorphine, LAAM, or naltrexone, subjects on any medication other than oral or depot contraceptives and subjects with an injection phobia were excluded from the study. Furthermore, women candidates who were pregnant, lactating, or heterosexually active not using medically approved birth control measures were not eligible.
Opioid-dependent males and females, ages 18 to 55 years, were recruited. Volunteers were not concurrently seeking treatment for their drug use, and were willing to participate in a short-term study involving methadone maintenance and detoxification, and a consecutive 8-night (9-day) inpatient stay with experimental sessions involving intravenous drug administrations. Each subject who was eligible to participate in the study was assigned a study number.
A complete medical and drug history was taken and a complete physical examination was performed on each subject, including a measurement of height and weight. Respiration rate, oxygen saturation, heart rate, and blood pressure were measured during all test sessions using a Welch Allyn Noninvasive Patient Monitor. Vital signs including respiration rate, heart rate, systolic and diastolic blood pressure and oxygen saturation were measured prior to each dose and at 5, 10, 15, 30, 45 and 60 minutes after each dose. Each subject's oxyhemoglobin saturation was closely monitored. If the subject's oxyhemoglobin saturation remained below 90% for more than 1 minute, oxygen was administered to the subject via a nasal cannula, an adverse event was documented and the subject was monitored. Subjects requiring oxygen administration were excluded from further study participation. A 12-lead electrocardiogram was obtained for each subject at screening. Females of childbearing potential had a urine pregnancy test performed according to the study schedule. A positive result at any time during the study excluded the subject from participating in the trial. All adverse events were recorded.
The laboratory tests listed in the following table were obtained according to the study schedule for each subject. All clinically significant laboratory abnormal values were specifically noted.
BLOOD
HEMATOLOGY
CHEMISTRY
OTHER
Hemoglobin
Sodium
Urinalysis
Hematocrit
Potassium
Urine drug screen
Platelet Count
Chloride
Urinary beta-HCG
RBC Count
Bicarbonate
(females only)
White Blood Cell
Calcium
Count Differential,
Phosphorus (inorganic)
including:
Glucose
Neutrophils
Urea Nitrogen
Lymphocytes
Creatinine
Monocytes
Uric Acid
Eosinophils
Cholesterol
Basophils
Bilirubin (total)
Protein (total)
Albumin
SGOT (AST)
SGPT (ALT)
Alkaline Phosphatase
A Mantoux/PPD tuberculosis skin test was administered into the epidermis of the inner forearm of the subjects and the site of injection was marked. Forty-eight to 72 hours after the test was administered, the test results were read to determine if the test site was raised and felt hard to the touch. Subjects with a positive PPD test were referred to the community health program (CHP) to receive a chest X-ray. If the X-ray was positive (definition of having tuberculosis), the subject was informed and referred for treatment.
Subjects were asked to complete certain questionnaires, for example, an Injection Phobia Questionnaire, questions regarding the Shipley Institute of Living Scale (used to derive IQ), an Opioid Symptom Questionnaire, a Visual analog scale (VAS) rating of subjective drug effect, questions regarding a Drug reinforcing value (e.g., to make independent choices between drug and money), and an observer-rated withdrawal assessment
Treatment
All experimental doses were administered by intravenous injection in a double-blind manner. The starting IV fentanyl dose was 0.6 mg (600 μg) in combination with 0.15, 0.3 and 0.6 mg naloxone. This fentanyl dose corresponded to an intermediate-sized transmucosal formulation of fentanyl, thereby providing a reasonable test of a potentially abusable dose. Depending on the initial results, the fentanyl was adjusted either upward (to a maximum of 0.8 mg) or downward (to a minimum of 0.2 mg). If dose adjustments were made, the naloxone dose was adjusted according to the following ratios: (1) placebo, (2) fentanyl≦0.8 mg+naloxone placebo, (3) fentanyl ≦0.8 mg+naloxone at 25% of the dose of fentanyl, (4), fentanyl≦0.8 mg+naloxone at 50% of the dose of fentanyl, and (5) fentanyl≦0.8 mg+naloxone at 100% of the dose of fentanyl.
Subjects were maintained on a target dose of methadone for 10 days prior to the first experimental session. Subjects also received methadone maintenance (50 mg daily) on days without experimental procedures.
Beginning on the first day of the study period and continuing each day, subjects received one of the 5 study treatments by intravenous injection at the same time each day. The timeline below indicates the times at which drug was administered and assessments were performed.
Time
−30 min
0 min
+5 min
+15 min
+30 min
+45 min
+60 min
(0930)
(1000)
(1005)
(1015)
(1030)
(1045)
(1100)
IV drug
x
Observer
x
x
x
x
Vitals
x
x
x
x
x
x
VAS
x
x
x
x
x
x
OSQ
x
x
x
x
x
x
MCP
x
Prior to the subjects' discharge on the last day, an evaluation of adverse events, a complete physical examination, laboratory tests and administration of first methadone detoxification dose are all performed.
Results from initial subjects are shown in FIG. 1. As can be seen in FIG. 1, there was no positive or negative effects from the placebo, there was only a positive effect from the fentanyl alone, there was no positive and some significant negative effects with fentanyl plus 25% naloxone, and there was major negative effects with fentanyl plus 50% naloxone.
Example 2
Extraction of Fentanyl and Naloxone in Water and Ethanol
A 3.11 cm2 bilayered transmucosal disc was placed in 100 mL of 0.1N HCl and 0.1N NaOH. The disc was allowed to dissolve over a period of 30 minutes, and the amount of naloxone was measured using a high performance liquid chromatography. At 30 minutes, 100% naloxone and 100% fentanyl was extracted under acidic conditions, while 15% naloxone and 2% fentanyl was measured at a pH 12. The remaining amount was expected to settle at the bottom of the flask with other insoluble excipients. A 3.11 cm2 bilayered transmucosal disc as described herein was placed in 100 mL of ethanol. HPLC results show both naloxone and fentanyl present.
Example 3
Extraction of Buprenorphine and Naloxone in an Aqueous Solvent
A 2.3 cm2 disc containing buprenorphine in the mucoadhesive layer and naloxone in the backing layer was prepared and placed in pH 7.4 Phosphate buffered solution in a Van Henkel USP dissolution apparatus at 50 RPM. The result of the dissolution experiment is shown in the table below.
Number of Minutes in
Aqueous Solvent
Buprenorphine
Naloxone
5
18.0%
20.3%
15
38.5%
48.0%
30
60.5%
72.1%
45
84.1%
83.2%
60
100.2%
86.2%
75
106.7%
86.2%
120
108.9%
85.8%
180
109.4%
87.4%
As can be seen in the table, naloxone and buprenorphine extract simultaneously up to 180 minutes. Thus, they can not be extracted separately via dissolution.
|
11639408
|
biodelivery sciences international, inc.
|
USA
|
B2
|
Utility Patent Grant (with pre-grant publication) issued on or after January 2, 2001.
|
Open
|
|
|
Mar 30th, 2022 06:04PM
|
Mar 30th, 2022 06:04PM
|
BioDelivery Sciences
|
|
Pharmaceuticals & Biotechnology
|
|
nasdaq:bdsi
|
BioDelivery Sciences
|
May 23rd, 2017 12:00AM
|
Jul 18th, 2016 12:00AM
|
https://www.uspto.gov?id=US09655843-20170523
|
Transmucosal delivery devices with enhanced uptake
|
The present invention provides methods for enhancing transmucosal uptake of a medicament, e.g., fentanyl or buprenorphine, to a subject and related devices. The method includes administering to a subject a transmucosal drug delivery device comprising the medicament. Also provided are devices suitable for transmucosal administration of a medicament to a subject and methods of their administration and use. The devices include a medicament disposed in a mucoadhesive polymeric diffusion environment and a barrier environment.
|
9655843
|
1. A method for delivering buprenorphine to a human comprising:
administering a mucoadhesive biodegradable drug delivery device for transmucosal delivery, the device comprising:
a bioerodible mucoadhesive layer comprising buprenorphine disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH of between about 4 and about 7.5, and
a polymeric barrier environment disposed adjacent to the mucoadhesive layer, and wherein a unidirectional diffusion gradient of buprenorphine is provided upon application to a buccal surface.
2. The method of claim 1, wherein the polymeric diffusion environment comprises at least one film-forming water-erodible adhesive polymer and at least one bioadhesive polymer.
3. The method of claim 1, wherein said polymeric barrier environment comprises at least one film-forming water-erodible polymer.
4. The method of claim 1, wherein the polymeric diffusion environment has a pH of between about 4 to about 6.
5. The method of claim 1, wherein the polymeric barrier environment further comprises an opioid antagonist.
6. The method of claim 1, wherein the biodegradable drug delivery device further comprises a third layer or coating.
7. The method of claim 1, wherein the polymeric diffusion environment has a pH buffered to between about 4 and about 7.5.
8. The method of claim 1, wherein the polymeric diffusion environment has a pH buffered to between about 4 to about 6.
9. The method of claim 7, wherein the polymeric diffusion environment comprises at least one film-forming water-erodible adhesive polymer and at least one bioadhesive polymer.
10. The method of claim 7, wherein said polymeric barrier environment comprises at least one film-forming water-erodible polymer.
11. The method of claim 7, wherein the polymeric barrier environment further comprises an opioid antagonist.
12. The method of claim 7, wherein the biodegradable drug delivery device further comprises a third layer or coating.
13. A device for delivering buprenorphine to a human, the device comprising:
a bioerodible mucoadhesive layer comprising buprenorphine disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH of between about 4 and about 7.5; and
a polymeric barrier environment disposed adjacent to the mucoadhesive layer, and wherein a unidirectional diffusion gradient of buprenorphine is provided upon application to a buccal surface of a human.
14. The device of claim 13, wherein the polymeric diffusion environment comprises at least one film-forming water-erodible adhesive polymer and at least one bioadhesive polymer.
15. The device of claim 13, wherein said polymeric barrier environment comprises at least one film-forming water-erodible polymer.
16. The device of claim 13, wherein the polymeric diffusion environment has a pH of between about 4 and about 6.
17. The device of claim 13, wherein the polymeric barrier environment further comprises an opioid antagonist.
18. The device of claim 13, wherein the biodegradable drug delivery device further comprises a third layer or coating.
19. The device of claim 13, wherein the polymeric diffusion environment has a pH buffered to between about 4 and about 7.5.
20. The device of claim 13, wherein the polymeric diffusion environment has a pH buffered to between about 4 to about 6.
21. The device of claim 19, wherein the polymeric diffusion environment comprises at least one film-forming water-erodible adhesive polymer and at least one bioadhesive polymer.
22. The device of claim 19, wherein said polymeric barrier environment comprises at least one film-forming water-erodible polymer.
23. The device of claim 19, wherein the polymeric barrier environment further comprises an opioid antagonist.
24. The device of claim 19, wherein the biodegradable drug delivery device further comprises a third layer or coating.
25. A method for treating pain, the method comprising:
adhering a mucoadhesive biodegradable drug delivery device to a buccal surface of a human, the device comprising:
a bioerodible mucoadhesive layer comprising a therapeutically effective amount of buprenorphine for treating pain disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH buffered to between about 4 and about 7.5; and
a polymeric barrier environment disposed adjacent to the mucoadhesive layer wherein a unidirectional diffusion gradient of buprenorphine is provided upon application to the buccal surface.
|
25
|
RELATED APPLICATIONS
This application is a continuation of U.S. patent application Ser. No. 14/746,168 filed Jun. 22, 2015, which is a continuation of U.S. patent application Ser. No. 13/413,112, filed Mar. 6, 2012, which is a continuation of U.S. patent application Ser. No. 13/184,306, filed Jun. 15, 2011, which is a continuation of U.S. patent application Ser. No. 11/817,915, filed Oct. 6, 2009, which is a U.S. National Phase of PCT/US2007/016634, filed Jul. 23, 2007. PCT/US2007/016634 claims priority to U.S. Provisional Application No. 60/832,725, filed Jul. 21, 2006, U.S. Provisional Application No. 60/832,726, filed Jul. 21, 2006, and U.S. Provisional Application No. 60/839,504, filed Aug. 23, 2006. The entire contents of these applications are incorporated herein by reference. This application is also related to U.S. Ser. No. 11/639,408, filed Dec. 13, 2006, and PCT/US2006/47686, also filed Dec. 13, 2006, both of which claim priority to U.S. Provisional Application No. 60/750,191, filed Dec. 13, 2005, and 60/764,618, filed Feb. 2, 2006. The entire contents of these applications are also incorporated herein by this reference.
BACKGROUND
U.S. Pat. No. 6,264,981 (Zhang et al.) describes delivery devices, e.g., tablets of compressed powders that include a solid solution micro-environment formed within the drug formulation. The micro-environment includes a solid pharmaceutical agent in solid solution with a dissolution agent that that facilitates rapid dissolution of the drug in the saliva. The micro-environment provides a physical barrier for preventing the pharmaceutical agent from being contacted by other chemicals in the formulation. The micro-environment may also create a pH segregation in the solid formulation. The pH of the micro-environment is chosen to retain the drug in an ionized form for stability purposes. The rest of the formulation can include buffers so that, upon dissolution in the oral cavity, the pH is controlled in the saliva such that absorption of the drug is controlled.
US Publication 2004/0253307 also describes solid dosage forms that include buffers that upon dissolution of the solid dosage form maintains the pharmaceutical agent at a desired pH to control absorption, i.e., to overcome the influence of conditions in the surrounding environment, such as the rate of saliva secretion, pH of the saliva and other factors.
BRIEF SUMMARY OF THE INVENTION
The present invention provides transmucosal devices for enhanced uptake of a medicament and methods of making and using the same. In some embodiments, the devices generally include a mucoadhesive polymeric diffusion environment that facilitates not only the absorption of the medicament across the mucosal membrane to which it is applied, but additionally, the permeability and/or motility of the medicament through the mucoadhesive polymeric diffusion environment to the mucosa.
Accordingly, in one embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of a fentanyl or fentanyl derivative to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: a fentanyl or fentanyl derivative disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface and the fentanyl or fentanyl derivative is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of a fentanyl or fentanyl derivative disposed in a mucoadhesive polymeric diffusion environment such that the effective amount of the fentanyl or fentanyl derivative is delivered in less than about 30 minutes. In some embodiments, chronic pain is alleviated in the subject. In other embodiments, acute pain is alleviated in the subject. In other embodiments, the pain is breakthrough cancer pain.
In yet another embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of a fentanyl or fentanyl derivative to a subject. The mucoadhesive device generally includes a fentanyl or fentanyl derivative disposed in a polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is upon application to a mucosal surface.
In another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative with at least 50% direct buccal absorption and an absolute bioavailability of at least about 70%. In yet another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative directly to the mucosa to achieve onset of pain relief (Tfirst) of about 0.20 hours or less and time to peak plasma concentration (Tmax) of about 1.6 hours or more. In still another embodiment, the present invention is directed to devices comprising about 800 μg of fentanyl, which exhibit upon transmucosal administration to a subject at least one in vivo plasma profile as follows: a Cmax of about 1.10 ng/mL or more; a Tfirst of about 0.20 hours or less; and an AUC0-24 of about 10.00 hr·ng/mL or more. In yet another embodiment, the present invention is directed to transmucosal delivery devices which include a fentanyl or fentanyl derivative that delivers the fentanyl or fentanyl derivative in an amount effective to treat pain, wherein oral irritation, oral ulceration and/or constipation associated with the delivery of the fentanyl or fentanyl derivative is insignificant or eliminated. In one embodiment, the pH of the mucoadhesive polymeric diffusion environment is between about 6.5 and about 8, e.g., about 7.25. In one embodiment, the device comprises about 800 μg of fentanyl. In another embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the fentanyl or fentanyl derivative to the mucosa. In another embodiment, the fentanyl is fentanyl citrate.
In one embodiment, more than 30% of the fentanyl, e.g., more than 55% of the fentanyl, in the device becomes systemically available via mucosal absorption.
In one embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of buprenorphine to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: buprenorphine disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface, and the buprenorphine is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of buprenorphine disposed in a mucoadhesive polymeric diffusion environment such that the effective amount of the buprenorphine is delivered in less than about 30 minutes. In some embodiments, chronic pain is alleviated in the subject. In other embodiments, acute pain is alleviated in the subject. In other embodiments, the pain is breakthrough cancer pain.
In yet another embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of buprenorphine to a subject. The mucoadhesive device generally includes buprenorphine disposed in a polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to a mucosal surface. In one embodiment, the pH is between about 4.0 and about 7.5, e.g., about 6.0 or about 7.25. In another embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the buprenorphine to the mucosa.
In one embodiment of the methods and devices of the present invention, the device comprises a pH buffering agent. In one embodiment of the methods and devices of the present invention, the device is adapted for buccal administration or sublingual administration.
In one embodiment of the methods and devices of the present invention, the device is a mucoadhesive disc. In one embodiment of the methods and devices of the present invention, the medicament is formulated as a mucoadhesive film formed to delineate different dosages. In one embodiment of the methods and devices of the present invention, the device comprises a backing layer disposed adjacent to the mucoadhesive polymeric diffusion environment.
In one embodiment of the methods and devices of the present invention, the device further comprises an opioid antagonist. In one embodiment of the methods and devices of the present invention, the device further comprises naloxone.
In one embodiment of the methods and devices of the present invention, the device is a layered, flexible device. In one embodiment of the methods and devices of the present invention, the mucoadhesive polymeric diffusion environment has a buffered environment for the transmucosal administration.
In one embodiment of the methods and devices of the present invention, there is substantially no irritation at the site of transmucosal administration. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 30 minutes.
In one embodiment of the methods and devices of the present invention, the polymeric diffusion environment comprises at least one ionic polymer system, e.g., polyacrylic acid (optionally crosslinked), sodium carboxymethylcellulose and mixtures thereof. In one embodiment, the polymeric diffusion environment comprises a buffer system, e.g., citric acid, sodium benzoate or mixtures thereof. In some embodiments, the device has a thickness such that it exhibits minimal mouth feel. In some embodiments, the device has a thickness of about 0.25 mm.
In some embodiments, the present invention provides a flexible, bioerodable mucoadhesive delivery device suitable for direct transmucosal administration of an effective amount of a fentanyl, fentanyl derivative, buprenorphine or buprenorphine derivative to a subject. The mucoadhesive device includes a mucoadhesive layer comprising a fentanyl, fentanyl derivative, buprenorphine or buprenorphine derivative disposed in a polymeric diffusion environment, wherein the polymeric diffusion environment has a pH of about 7.25 for the fentanyl or fentanyl derivative or a pH of about 6 for the buprenorphine or buprenorphine derivative; and a backing layer comprising a barrier environment which is disposed adjacent to and coterminous with the mucoadhesive layer. The device has no or minimal mouth feel and is able to transmucosally deliver the effective amount of the, fentanyl derivative, buprenorphine or buprenorphine derivative in less than about 30 minutes; and wherein a unidirectional gradient is created upon application of the device to a mucosal surface.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other aspects, embodiments, objects, features and advantages of the invention can be more fully understood from the following description in conjunction with the accompanying figures.
FIGS. 1 and 2 are graphs comparing fentanyl citrate uptake in humans over 2 days post-administration, and 1 hour post-administration, respectively, for exemplary embodiments of the present invention and a commercially available delivery device (Actiq® Oral Transmucosal Fentanyl Citrate) as described in Examples 1 and 2.
FIG. 3 is a graph comparing buprenorphine uptake in humans over 16 hours post-administration, respectively, for exemplary embodiments of the present invention and a commercially available delivery devices as described in Examples 3 and 4.
FIGS. 4A-C are schematic representations of exemplary embodiments of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based, at least in part, on the discovery that transmucosal uptake of medicaments can be enhanced by employing a novel polymeric diffusion environment. Such a polymeric diffusion environment is advantageous, e.g., because the absolute bioavailability of the medicament contained therein is enhanced, while also providing a rapid onset. Additionally, less medicament is needed in the device to deliver a therapeutic effect versus devices of the prior art. This renders the device less abusable, an important consideration when the medicament is a controlled substance, such as an opioid. The polymeric diffusion environment described in more detail herein, provides an enhanced delivery profile and more efficient delivery of the medicament. Additional advantages of a polymeric diffusion environment are also described herein.
In order to more clearly and concisely describe the subject matter of the claims, the following definitions are intended to provide guidance as to the meaning of terms used herein.
As used herein, the articles “a” and “an” mean “one or more” or “at least one,” unless otherwise indicated. That is, reference to any element of the present invention by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present.
As used herein, the term “acute pain” refers to pain characterized by a short duration, e.g., three to six months. Acute pain is typically associated with tissue damage, and manifests in ways that can be easily described and observed. It can, for example, cause sweating or increased heart rate. Acute pain can also increase over time, and/or occur intermittently.
As used herein, the term “chronic pain” refers to pain which persists beyond the usual recovery period for an injury or illness. Chronic pain can be constant or intermittent. Common causes of chronic pain include, but are not limited to, arthritis, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), repetitive stress injuries, shingles, headaches, fibromyalgia, and diabetic neuropathy.
As used herein, the term “breakthrough pain” refers to pain characterized by frequent and intense flares of moderate to severe pain which occur over chronic pain, even when a subject is regularly taking pain medication. Characteristics of breakthrough pain generally include: a short time to peak severity (e.g., three to five minutes); excruciating severity; relatively short duration of pain (e.g., 15 to 30 minutes); and frequent occurrence (e.g., one to five episodes a day). Breakthrough pain can occur unexpectedly with no obvious precipitating event, or it can be event precipitated. The occurrence of breakthrough pain is predictable about 50% to 60% of the time. Although commonly found in patients with cancer, breakthrough pain also occurs in patients with lower back pain, neck and shoulder pain, moderate to severe osteoarthritis, and patients with severe migraine.
As used herein, unless indicated otherwise, the term “fentanyl”, includes any pharmaceutically acceptable form of fentanyl, including, but not limited to, salts, esters, and prodrugs thereof. The term “fentanyl” includes fentanyl citrate. As used herein, the term “fentanyl derivative” refers to compounds having similar structure and function to fentanyl. In some embodiments, fentanyl derivatives include those of the following formula:
or pharmaceutically acceptable salts or esters thereof, wherein
R1 is selected from an aryl group, a heteroaryl group or a COO—C1-4 alkyl group; and R2 is selected from —H, a —C1-4 alkyl-O—C1-4 alkyl group or a —COO—C1-4 alkyl group.
Fentanyl derivatives include, but are not limited to, alfentanil, sufentanil, remifentanil and carfentanil.
As used herein, unless indicated otherwise, the term “buprenorphine”, includes any pharmaceutically acceptable form of buprenorphine, including, but not limited to, salts, esters, and prodrugs thereof. As used herein, the term “buprenorphine derivative” refers to compounds having similar structure and function to buprenorphine. In some embodiments, fentanyl derivatives include those of the following formula:
or pharmaceutically acceptable salts or esters thereof, wherein
is a double or single bond; R3 is selected from a —C1-4 alkyl group or a cycloalkyl-substituted-C1-4 alkyl group; R4 is selected from a —C1-4 alkyl; R5 is —OH, or taken together, R4 and R5 form a ═O group; and R6 is selected from —H or a —C1-4 alkyl group.
Buprenorphine derivatives include, but are not limited to, etorphine and diprenorphine.
As used herein, “polymeric diffusion environment” refers to an environment capable of allowing flux of a medicament to a mucosal surface upon creation of a gradient by adhesion of the polymeric diffusion environment to a mucosal surface. The flux of a transported medicament is proportionally related to the diffusivity of the environment which can be manipulated by, e.g., the pH, taking into account the ionic nature of the medicament and/or the ionic nature polymer or polymers included in the environment and.
As used herein, “barrier environment” refers to an environment in the form of, e.g., a layer or coating, capable of slowing or stopping flux of a medicament in its direction. In some embodiments, the barrier environment stops flux of a medicament, except in the direction of the mucosa. In some embodiments, the barrier significantly slows flux of a medicament, e.g., enough so that little or no medicament is washed away by saliva.
As used herein, the term “unidirectional gradient” refers to a gradient which allows for the flux of a medicament (e.g., fentanyl or buprenorphine) through the device, e.g., through a polymeric diffusion environment, in substantially one direction, e.g., to the mucosa of a subject. For example, the polymeric diffusion environment may be a mucoadhesive polymeric diffusion environment in the form of a layer or film disposed adjacent to a backing layer or film. Upon mucoadministration, a gradient is created between the mucoadhesive polymeric diffusion environment and the mucosa, and the medicament flows from the mucoadhesive polymeric diffusion environment, substantially in one direction towards the mucosa. In some embodiments, some flux of the medicament is not entirely unidirectional across the gradient; however, there is typically not free flux of the medicament in all directions. Such unidirectional flux is described in more detail herein, e.g., in relation to FIG. 4.
As used herein, “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of preventing, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder (e.g., to alleviate pain).
The term “subject” refers to living organisms such as humans, dogs, cats, and other mammals. Administration of the medicaments included in the devices of the present invention can be carried out at dosages and for periods of time effective for treatment of a subject. In some embodiments, the subject is a human. In some embodiments, the pharmacokinetic profiles of the devices of the present invention are similar for male and female subjects. An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
The term “transmucosal,” as used herein, refers to any route of administration via a mucosal membrane. Examples include, but are not limited to, buccal, sublingual, nasal, vaginal, and rectal. In one embodiment, the administration is buccal. In one embodiment, the administration is sublingual. As used herein, the term “direct transmucosal” refers to mucosal administration via the oral mucosa, e.g., buccal and/or sublingual.
As used herein, the term “water erodible” or “at least partially water erodible” refers to a substance that exhibits a water erodibility ranging from negligible to completely water erodible. The substance may readily dissolve in water or may only partially dissolve in water with difficulty over a long period of time. Furthermore, the substance may exhibit a differing erodibility in body fluids compared with water because of the more complex nature of body fluids. For example, a substance that is negligibly erodible in water may show an erodibility in body fluids that is slight to moderate. However, in other instances, the erodibility in water and body fluid may be approximately the same.
The present invention provides transmucosal delivery devices that uniformly and predictably deliver a medicament to a subject. The present invention also provides methods of delivery of a medicament to a subject employing devices in accordance with the present invention. Accordingly, in one embodiment, the present invention is directed to mucoadhesive delivery devices suitable for direct transmucosal administration of an effective amount of a medicament, e.g., fentanyl or fentanyl derivative or buprenorphine to a subject. The mucoadhesive device generally includes a medicament disposed in a polymeric diffusion environment; and a having a barrier such that a unidirectional gradient is created upon application to a mucosal surface, wherein the device is capable of delivering in a unidirectional manner the medicament to the subject. The present invention also provides methods of delivery of a medicament to a subject employing the devices in accordance with the present invention.
In another embodiment, the present invention is directed to methods for enhancing direct transmucosal delivery of a medicament, e.g., fentanyl, fentanyl derivatives and/or buprenorphine, to a subject. The method generally includes administering a bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising: a medicament disposed in a mucoadhesive polymeric diffusion environment; and a barrier environment disposed relative to the polymeric diffusion environment such that a unidirectional gradient is created upon application to the mucosal surface, wherein an effective amount of the medicament is delivered to the subject.
In another embodiment, the present invention is directed to methods for treating pain in a subject. The method generally includes transmucosally administering to a subject a therapeutically effective amount of a medicament, e.g., fentanyl, fentanyl derivatives and/or buprenorphine, disposed in a mucoadhesive polymeric diffusion environment having a thickness such that the effective amount of the medicament is delivered in less than about 30 minutes and such that pain is treated. In some embodiments, the medicament is delivered in less than about 25 minutes. In some embodiments, the medicament is delivered in less than about 20 minutes.
In some embodiments of the above methods and devices, an effective amount is delivered transmucosally. In other embodiments, an effective amount is delivered transmucosally and by gastrointestinal absorption. In still other embodiments, an effective amount is delivered transmucosally, and delivery though the gastrointestinal absorption augments and/or maintains treatment, e.g., pain relief for a desired period of time, e.g., at least 1, 1.5, 2, 2.5, 3, 3.5, or 4 or more hours.
In yet another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative directly to the mucosa to achieve onset of pain relief (Tfirst) of about 0.20 hours or less and time to peak plasma concentration (Tmax) of about 1.6 hours or more. The combination of a rapid onset with a delayed maximum concentration is particularly advantageous when treating pain, e.g., relief for breakthrough cancer pain (BTP) in opioid tolerant patients with cancer, because immediate relief is provided to alleviate a flare of moderate to severe pain but persistence is also provided to alleviate subsequent flares. Conventional delivery systems may address either the immediate relief or subsequent flare-ups, but the devices of this embodiment are advantageous because they address both.
TABLE 1
Selected Pharmacokinetic properties of transmucosal devices.
Total
Tfirst
Tmax
Bioavailability
BEMA pH 7.25
0.15 hours
1.61 hours
70%
Actiq ®
0.23 hours
2.28 hours
47%
Fentora ®
0.25 hours*
0.50 hours
65%
*reported as onset of main relief, first time point measured.
The devices of the present invention may have a number of additional or alternative desirable properties, as described in more detail herein. Accordingly, in another embodiment, the present invention is directed to transmucosal delivery devices that deliver a fentanyl or fentanyl derivative with at least 50% direct buccal absorption and an absolute bioavailability of at least about 70%. In still another embodiment, the present invention is directed to devices comprising about 800 μg of fentanyl, which exhibit upon transmucosal administration to a subject at least one in vivo plasma profile as follows: a Cmax of about 1.10 ng/mL or more; a Tfirst of about 0.20 hours or less; and an AUC0-24 of about 10.00 hr·ng/mL or more.
The pain can be any pain known in the art, caused by any disease, disorder, condition and/or circumstance. In some embodiments, chronic pain is alleviated in the subject using the methods of the present invention. In other embodiments, acute pain is alleviated in the subject using the methods of the present invention. Chronic pain can arise from many sources including, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), and migraine. Acute pain is typically directly related to tissue damage, and lasts for a relatively short amount of time, e.g., three to six months. In other embodiments, the pain is breakthrough cancer pain. In some embodiments, the methods and devices of the present invention can be used to alleviate breakthrough pain in a subject. For example, the devices of the present invention can be used to treat breakthrough pain in a subject already on chronic opioid therapy. In some embodiments, the devices and methods of the present invention provide rapid analgesia and/or avoid the first pass metabolism of fentanyl, thereby resulting in more rapid breakthrough pain relief than other treatments, e.g., oral medications.
In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 60% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 70% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 80% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 90% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 100% decrease in pain over about 30 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 25 minutes. In one embodiment of the methods and devices of the present invention, the subject experienced about a 50% decrease in pain over about 20 minutes.
Without wishing to be bound by any particular theory, it is believed that delivery of the medicament is particularly effective because the mucoadhesive polymeric diffusion environment (e.g., the pH and the ionic nature of the polymers) is such that the medicament (e.g., a weakly basic drug such as fentanyl or buprenorphine) can rapidly move through the mucoadhesive polymeric diffusion environment to the mucosa, while also allowing efficient absorption by the mucosa. For example, in some embodiments, the pH is low enough to allow movement of the medicament, while high enough for absorption.
In some embodiments, the mucoadhesive polymeric diffusion environment is a layer with a buffered pH such that a desired pH is maintained at the mucosal administration site. Accordingly, the effect of any variation in pH encountered in a subject or between subjects (e.g., due to foods or beverages recently consumed), including any effect on uptake, is reduced or eliminated.
Accordingly, one advantage of the present invention is that variability in the properties of the device (e.g., due to changes in the pH of the ingredients) between devices, and from lot to lot is reduced or eliminated. Without wishing to be bound by any particular theory, it is believed that the polymeric diffusion environment of the present invention reduces variation, e.g., by maintaining a buffered pH. Yet another advantage is pH variability at the administration site (e.g., due to what food or drink or other medications was recently consumed) is reduced or eliminated, such that, e.g., the variability of the devices is reduced or eliminated.
A medicament for use in the present invention includes any medicament capable of being administered transmucosally. The medicament can be suitable for local delivery to a particular mucosal membrane or region, such as the buccal and nasal cavities, throat, vagina, alimentary canal or the peritoneum. Alternatively, the medicament can be suitable for systemic delivery via such mucosal membranes.
In one embodiment, the medicament can be an opioid. Opioids suitable for use in the present invention include, e.g., alfentanil, allylprodine, alphaprodine, apomorphine, anileridine, apocodeine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, cyclorphan, cyprenorphine, desomorphine, dextromoramide, dextropropoxyphene, dezocine, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, eptazocine, ethylmorphine, etonitazene, etorphine, fentanyl, fencamfamine, fenethylline, hydrocodone, hydromorphone, hydroxymethylmorphinan, hydroxypethidine, isomethadone, levomethadone, levophenacylmorphan, levorphanol, lofentanil, mazindol, meperidine, metazocine, methadone, methylmorphine, modafinil, morphine, nalbuphene, necomorphine, normethadone, normorphine, opium, oxycodone, oxymorphone, pholcodine, profadol remifentanil, sufentanil, tramadol, corresponding derivatives, physiologically acceptable compounds, salts and bases. In some embodiments, the medicament is fentanyl, e.g., fentanyl citrate. In some embodiments, the medicament is buprenorphine.
The amount of medicament, e.g. fentanyl or buprenorphine, to be incorporated into the device of the present invention depends on the desired treatment dosage to be administered, e.g., the fentanyl or fentanyl derivative can be present in about 0.001% to about 50% by weight of the device of the present invention, and in some embodiments between about 0.005 and about 35% by weight or the buprenorphine can be present in about 0.001% to about 50% by weight of the device of the present invention, and in some embodiments between about 0.005 and about 35% by weight. In one embodiment, the device comprises about 3.5% to about 4.5% fentanyl or fentanyl derivative by weight. In one embodiment, the device comprises about 3.5% to about 4.5% buprenorphine by weight. In another embodiment, the device comprises about 800 μg of a fentanyl such as fentanyl citrate. In another embodiment the device comprises about 25, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, 1600 or 2000 μg of a fentanyl such as fentanyl citrate or fentanyl derivative. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention. In another embodiment, the device comprises about 800 μg of buprenorphine. In another embodiment the device comprises about 100, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, or 2000 μg of buprenorphine. In another embodiment the device comprises about 25, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 900, 1000, 1200, 1500, 1600 or 2000 μg of any of the medicaments described herein.
One approach to reaching an effective dose is through titration with multiple dosage units such that patients start with a single 200 mcg unit and progressively increase the number of units applied until reaching an effective dose or 800 mcg (4 units) dose as the multiple discs once an effective dose has been identified. Accordingly, in some embodiments, the methods of the present invention also include a titration phase to identify a dose that relieves pain and produces minimal toxicity, because the dose of opioid, e.g., fentanyl, required for control of breakthrough pain episodes is often not easily predicted. The linear relationship between surface area of the devices of the present invention and pharmacokinetic profile may be exploited in the dose titration process through the application of single or multiple discs to identify an appropriate dose, and then substitution of a single disc containing the same amount of medicament.
In one embodiment, the devices of the present invention are capable of delivering a greater amount of fentanyl systemically to the subject than conventional devices. According to the label for Actiq® Oral Transmucosal Fentanyl Citrate, approximately 25% of the fentanyl in the ACTIQ product is absorbed via the buccal mucosa, and of the remaining 75% that is swallowed, another 25% of the total fentanyl becomes available via absorption in the GI tract for a total of 50% total bioavailability. According to Fentora Fentanyl Buccal tablet literature, approximately 48% of the fentanyl in FENTORA product is absorbed via the buccal mucosa, and of the remaining 52%, another 17% of the total fentanyl becomes available via absorption in the GI tract for a total of 65% total bioavailability. Accordingly, in some embodiments, more than about 30% of the fentanyl disposed in the devices of the present invention becomes systemically available or bioavailable via absorption by the mucosa. In some embodiments, more than about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% becomes systemically available via mucosal absorption. In some embodiments, more than about 55%, 60%, 65% or 70% of the fentanyl disposed in the devices of the present invention becomes systemically available or bioavailable by any route, mucosal and/or GI tract. In some embodiments, more than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% becomes systemically available.
Accordingly, another advantage of the devices and methods of the present invention is that because the devices of the present invention more efficiently deliver the medicament, e.g., fentanyl or buprenorphine, than do conventional devices, less medicament can be included than must be included in conventional devices to deliver the same amount of medicament. Accordingly, in some embodiments, the devices of the present invention are not irritating to the mucosal surface on which it attaches. In some embodiments, the devices of the present invention cause little or no constipation, even when the devices include an opioid antagonist such as naloxone. In yet another embodiment, the present invention is directed to transmucosal delivery devices which include a fentanyl or fentanyl derivative that delivers the fentanyl or fentanyl derivative in an amount effective to treat pain, wherein oral irritation, oral ulceration and/or constipation associated with the delivery of the fentanyl or fentanyl derivative is not significant or eliminated.
Another advantage is the devices of the present invention are less subject to abuse than conventional devices because less medicament, e.g., fentanyl or buprenorphine, is required in the device, i.e., there is less medicament to be extracted by an abuser for injection into the bloodstream.
In some embodiments, the devices of the present invention have a dose response that is substantially directly proportional to the amount of medicament present in the device. For example, if the Cmax is 10 ng/mL for a 500 dose, then it is expected in some embodiments that a 1000 μg dose will provide a Cmax of approximately 20 ng/mL. Without wishing to be bound by any particular theory, it is believed that this is advantageous in determining a proper dose in a subject.
In some embodiments, the devices of the present invention further comprise an opioid antagonist in any of various forms, e.g., as salts, bases, derivatives, or other corresponding physiologically acceptable forms. Opioid antagonists for use with the present invention include, but are not limited to, naloxone, naltrexone, nalmefene, nalide, nalmexone, nalorphine, naluphine, cyclazocine, levallorphan and physiologically acceptable salts and solvates thereof, or combinations thereof. In one embodiment, the device further comprises naloxone.
In some embodiments, the properties of the polymeric diffusion environment are effected by its pH. In one embodiment, e.g., when the medicament is fentanyl, the pH of the mucoadhesive polymeric diffusion environment in the devices of the present invention is between about 6.5 and about 8. In another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 7.25. In another embodiment, the pH is between about 7.0 and about 7.5, or between about 7.25 and 7.5. In other embodiments, the pH is about 6.5, 7.0, 7.5, 8.0 or 8.5, or any incremental value thereof. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
In one embodiment, e.g., when the medicament is buprenorphine, the pH of the mucoadhesive polymeric diffusion environment in the devices of the present invention is between about 4.0 and about 7.5. In another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 6.0. In one embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 5.5 to about 6.5, or between about 6.0 and 6.5. In yet another embodiment, the pH of the mucoadhesive polymeric diffusion environment is about 7.25. In another embodiment, the pH is between about 7.0 and 7.5, or between about 7.25 and 7.5. In other embodiments, the pH of the device may be about 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, or 7.5, or any incremental value thereof. It is to be understood that all values and ranges between these values and ranges are meant to be encompassed by the present invention.
The pH of the mucoadhesive polymeric diffusion environment can be adjusted and/or maintained by methods including, but not limited to, the use of buffering agents, or by adjusting the composition of the device of the present invention. For example, adjustment of the components of the device of the present invention that influence pH, e.g., the amount of anti-oxidant, such as citric acid, contained in the device will adjust the pH of the device.
In some embodiments, the properties of the polymeric diffusion environment are effected by its buffering capacity. In some embodiments, buffering agents are included in the mucoadhesive mucoadhesive polymeric diffusion environment. Buffering agents suitable for use with the present invention include, for example, phosphates, such as sodium phosphate; phosphates monobasic, such as sodium dihydrogen phosphate and potassium dihydrogen phosphate; phosphates dibasic, such as disodium hydrogen phosphate and dipotassium hydrogen phosphate; citrates, such as sodium citrate (anhydrous or dehydrate); bicarbonates, such as sodium bicarbonate and potassium bicarbonate may be used. In one embodiment, a single buffering agent, e.g., a dibasic buffering agent is used. In another embodiment, a combination of buffering agents is employed, e.g., a combination of a tri-basic buffering agent and a monobasic buffering agent.
In one embodiment, the mucoadhesive polymeric diffusion environment of the device will have a buffered environment, i.e., a stabilized pH, for the transmucosal administration of a medicament. The buffered environment of the device allows for the optimal administration of the medicament to a subject. For example, the buffered environment can provide a desired pH at the mucosa when in use, regardless of the circumstances of the mucosa prior to administration.
Accordingly, in various embodiments, the devices include a mucoadhesive polymeric diffusion environment having a buffered environment that reduces or eliminates pH variability at the site of administration due to, for example, medications, foods and/or beverages consumed by the subject prior to or during administration. Thus, pH variation encountered at the site of administration in a subject from one administration to the next may have minimal or no effect on the absorption of the medicament. Further, pH variation at the administration site between different patients will have little or no effect on the absorption of the medicament. Thus, the buffered environment allows for reduced inter- and intra-subject variability during transmucosal administration of the medicament. In another embodiment, the present invention is directed to methods for enhancing uptake of a medicament that include administering to a subject a device including a medicament disposed in a mucoadhesive polymeric diffusion environment having a buffered environment for the transmucosal administration. In yet another embodiment, the present invention is directed to methods of delivering a therapeutically effective amount of a medicament to a subject that include administering a device including a medicament disposed in a mucoadhesive polymeric diffusion environment having a buffered environment for the transmucosal administration.
The devices of the present invention can include any combination or sub-combination of ingredients, layers and/or compositions of, e.g., the devices described in U.S. Pat. No. 6,159,498, U.S. Pat. No. 5,800,832, U.S. Pat. No. 6,585,997, U.S. Pat. No. 6,200,604, U.S. Pat. No. 6,759,059 and/or PCT Publication No. WO 05/06321. The entire contents of these patent and publications are incorporated herein by reference in their entireties.
In some embodiments, the properties of the polymeric diffusion environment are effected by the ionic nature of the polymers employed in the environment. In one embodiment, the mucoadhesive polymeric diffusion environment is water-erodible and can be made from a bioadhesive polymer(s) and optionally, a first film-forming water-erodible polymer(s). In one embodiment, the polymeric diffusion environment comprises at least one ionic polymer system, e.g., polyacrylic acid (optionally crosslinked), sodium carboxymethylcellulose and mixtures thereof.
In some embodiments, the mucoadhesive polymeric diffusion environment can include at least one pharmacologically acceptable polymer capable of bioadhesion (the “bioadhesive polymer”) and can optionally include at least one first film-forming water-erodible polymer (the “film-forming polymer”). Alternatively, the mucoadhesive polymeric diffusion environment can be formed of a single polymer that acts as both the bioadhesive polymer and the first film-forming polymer. Additionally or alternatively, the water-erodible mucoadhesive polymeric diffusion environment can include other first film-forming water-erodible polymer(s) and water-erodible plasticizer(s), such as glycerin and/or polyethylene glycol (PEG).
In some embodiments, the bioadhesive polymer of the water-erodible mucoadhesive polymeric diffusion environment can include any water erodible substituted cellulosic polymer or substituted olefinic polymer wherein the substituents may be ionic or hydrogen bonding, such as carboxylic acid groups, hydroxyl alkyl groups, amine groups and amide groups. For hydroxyl containing cellulosic polymers, a combination of alkyl and hydroxyalkyl groups will be preferred for provision of the bioadhesive character and the ratio of these two groups will have an effect upon water swellability and disperability. Examples include polyacrylic acid (PAA), which can optionally be partially crosslinked, sodium carboxymethyl cellulose (NaCMC), moderately to highly substituted hydroxypropylmethyl cellulose (HPMC), polyvinylpyrrolidone (PVP, which can optionally be partially crosslinked), moderately to highly substituted hydroxyethylmethyl cellulose (HEMC) or combinations thereof. In one embodiment, HEMC can be used as the bioadhesive polymer and the first film forming polymer as described above for a mucoadhesive polymeric diffusion environment formed of one polymer. These bioadhesive polymers are preferred because they have good and instantaneous mucoadhesive properties in a dry, system state.
The first film-forming water-erodible polymer(s) of the mucoadhesive polymeric diffusion environment can be hydroxyalkyl cellulose derivatives and hydroxyalkyl alkyl cellulose derivatives preferably having a ratio of hydroxyalkyl to alkyl groups that effectively promotes hydrogen bonding. Such first film-forming water-erodible polymer(s) can include hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropylmethyl cellulose (HPMC), hydroxyethylmethyl cellulose (HEMC), or a combination thereof. Preferably, the degree of substitution of these cellulosic polymers will range from low to slightly above moderate.
Similar film-forming water-erodible polymer(s) can also be used. The film-forming water-erodible polymer(s) can optionally be crosslinked and/or plasticized in order to alter its dissolution kinetics.
In some embodiments, the mucoadhesive polymeric diffusion environment, e.g., a bioerodable mucoadhesive polymeric diffusion environment, is generally comprised of water-erodible polymers which include, but are not limited to, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethylmethyl cellulose, polyacrylic acid (PAA) which may or may not be partially crosslinked, sodium carboxymethyl cellulose (NaCMC), and polyvinylpyrrolidone (PVP), or combinations thereof. Other mucoadhesive water-erodible polymers may also be used in the present invention. The term “polyacrylic acid” includes both uncrosslinked and partially crosslinked forms, e.g., polycarbophil.
In some embodiments, the mucoadhesive polymeric diffusion environment is a mucoadhesive layer, e.g, a bioerodable mucoadhesive layer. In some embodiments, the devices of the present invention include a bioerodable mucoadhesive layer which comprises a mucoadhesive polymeric diffusion environment.
In some embodiments, the properties of the polymeric diffusion environment are effected by the barrier environment. The barrier environment is disposed such that the flux of medicament is substantially unidirectional. For example, in an exemplary layered device of the present invention, having a layer comprising a medicament dispersed in a polymeric diffusion environment and a co-terminus barrier layer (see, e.g., FIG. 4B), upon application to the mucosa, some medicament may move to and even cross the boundary not limited by the mucosa or barrier layer. In another exemplary layered device of the present invention, a barrier layer does not completely circumscribe the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device (see, e.g., FIG. 4C). A majority of the medicament in both of these cases, however, flows towards the mucosa. In another exemplary layered device of the present invention, having a barrier layer which circumscribes the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device (see, e.g., FIG. 4A), upon application to the mucosa, substantially all of the medicament typically flows towards the mucosa.
The barrier environment can be, e.g., a backing layer. A backing layer can be included as an additional layer disposed adjacent to the mucoadhesive polymeric diffusion environment. The layers can be coterminous, or, e.g., the barrier layer may circumscribe the portion of the mucoadhesive polymeric diffusion environment that will not be in direct contact with the mucosa upon application of the device. In one embodiment, the device comprises a backing layer disposed adjacent to the mucoadhesive polymeric diffusion environment. The device of the present invention can also comprise a third layer or coating. A backing layer can be also included in the devices of the present invention as a layer disposed adjacent to a layer which is, in turn, disposed adjacent to the mucoadhesive polymeric diffusion environment (i.e., a three layer device).
In one embodiment, the device further comprises at least one additional layer that facilitates unidirectional delivery of the medicament to the mucosa. In one embodiment, the device of the present invention further comprises at least one additional layer disposed adjacent to the mucoadhesive polymeric diffusion environment. Such layer can include additional medicament or different medicaments, and/or can be present to further reduce the amount of medicament (originally in the mucoadhesive polymeric diffusion environment) that is washed away in the saliva.
Specialty polymers and non-polymeric materials may also optionally be employed to impart lubrication, additional dissolution protection, drug delivery rate control, and other desired characteristics to the device. These third layer or coating materials can also include a component that acts to adjust the kinetics of the erodability of the device.
The backing layer is a non-adhesive water-erodible layer that may include at least one water-erodible, film-forming polymer. In some embodiments, the backing layer will at least partially or substantially erode or dissolve before the substantial erosion of the mucoadhesive polymeric diffusion environment.
The barrier environment and/or backing layer can be employed in various embodiments to promote unidirectional delivery of the medicament (e.g., fentanyl) to the mucosa and/or to protect the mucoadhesive polymeric diffusion environment against significant erosion prior to delivery of the active to the mucosa. In some embodiments, dissolution or erosion of the water-erodible non-adhesive backing layer primarily controls the residence time of the device of the present invention after application to the mucosa. In some embodiments, dissolution or erosion of the barrier environment and/or backing layer primarily controls the directionality of medicament flow from the device of the present invention after application to the mucosa.
The barrier environment and/or backing layer (e.g., a water-erodible non-adhesive backing layer) can further include at least one water erodible, film-forming polymer. The polymer or polymers can include polyethers and polyalcohols as well as hydrogen bonding cellulosic polymers having either hydroxyalkyl group substitution or hydroxyalkyl group and alkyl group substitution preferably with a moderate to high ratio of hydroxyalkyl to alkyl group. Examples include, but are not limited to, hydroxyethyl cellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropylmethyl cellulose (HPMC), hydroxyethylmethyl cellulose (HEMC), polyvinyl alcohol (PVA), polyethylene glycol (PEG), polyethylene oxide (PEO), ethylene oxide-propylene oxide co polymers, and combinations thereof. The water-erodible non-adhesive backing layer component can optionally be crosslinked. In one embodiment, the water erodible non-adhesive backing layer includes hydroxyethyl cellulose and hydroxypropyl cellulose. The water-erodible non-adhesive backing layer can function as a slippery surface, to avoid sticking to mucous membrane surfaces.
In some embodiments, the barrier environment and/or backing layer, e.g., a bioerodible non-adhesive backing layer, is generally comprised of water-erodible, film-forming pharmaceutically acceptable polymers which include, but are not limited to, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxyethylmethyl cellulose, polyvinylalcohol, polyethylene glycol, polyethylene oxide, ethylene oxide-propylene oxide co-polymers, or combinations thereof. The backing layer may comprise other water-erodible, film-forming polymers.
The devices of the present invention can include ingredients that are employed to, at least in part, provide a desired residence time. In some embodiments, this is a result of the selection of the appropriate backing layer formulation, providing a slower rate of erosion of the backing layer. Thus, the non-adhesive backing layer is further modified to render controlled erodibility which can be accomplished by coating the backing layer film with a more hydrophobic polymer selected from a group of FDA approved Eudragit™ polymers, ethyl cellulose, cellulose acetate phthalate, and hydroxyl propyl methyl cellulose phthalate, that are approved for use in other pharmaceutical dosage forms. Other hydrophobic polymers may be used, alone or in combination with other hydrophobic or hydrophilic polymers, provided that the layer derived from these polymers or combination of polymers erodes in a moist environment. Dissolution characteristics may be adjusted to modify the residence time and the release profile of a drug when included in the backing layer.
In some embodiments, any of the layers in the devices of the present invention may also contain a plasticizing agent, such as propylene glycol, polyethylene glycol, or glycerin in a small amount, 0 to 15% by weight, in order to improve the “flexibility” of this layer in the mouth and to adjust the erosion rate of the device. In addition, humectants such as hyaluronic acid, glycolic acid, and other alpha hydroxyl acids can also be added to improve the “softness” and “feel” of the device. Finally, colors and opacifiers may be added to help distinguish the resulting non-adhesive backing layer from the mucoadhesive polymeric diffusion environment. Some opacifers include titanium dioxide, zinc oxide, zirconium silicate, etc.
Combinations of different polymers or similar polymers with definite molecular weight characteristics can be used in order to achieve preferred film forming capabilities, mechanical properties, and kinetics of dissolution. For example, polylactide, polyglycolide, lactide-glycolide copolymers, poly-e-caprolactone, polyorthoesters, polyanhydrides, ethyl cellulose, vinyl acetate, cellulose, acetate, polyisobutylene, or combinations thereof can be used.
The device can also optionally include a pharmaceutically acceptable dissolution-rate-modifying agent, a pharmaceutically acceptable disintegration aid (e.g., polyethylene glycol, dextran, polycarbophil, carboxymethyl cellulose, or poloxamers), a pharmaceutically acceptable plasticizer, a pharmaceutically acceptable coloring agent (e.g., FD&C Blue #1), a pharmaceutically acceptable opacifier (e.g., titanium dioxide), pharmaceutically acceptable anti-oxidant (e.g., tocopherol acetate), a pharmaceutically acceptable system forming enhancer (e.g., polyvinyl alcohol or polyvinyl pyrrolidone), a pharmaceutically acceptable preservative, flavorants (e.g., saccharin and peppermint), neutralizing agents (e.g., sodium hydroxide), buffering agents (e.g., monobasic, or tribasic sodium phosphate), or combinations thereof. Preferably, these components are individually present at no more than about 1% of the final weight of the device, but the amount may vary depending on the other components of the device.
The device can optionally include one or more plasticizers, to soften, increase the toughness, increase the flexibility, improve the molding properties, and/or otherwise modify the properties of the device. Plasticizers for use in the present invention can include, e.g., those plasticizers having a relatively low volatility such as glycerin, propylene glycol, sorbitol, ethylene glycol, diethylene glycol, triethylene glycol, propylene glycol, polypropylene glycol, dipropylene glycol, butylene glycol, diglycerol, polyethylene glycol (e.g., low molecular weight PEG's), oleyl alcohol, cetyl alcohol, cetostearyl alcohol, and other pharmaceutical-grade alcohols and diols having boiling points above about 100° C. at standard atmospheric pressure. Additional plasticizers include, e.g., polysorbate 80, triethyl titrate, acetyl triethyl titrate, and tributyl titrate. Additional suitable plasticizers include, e.g., diethyl phthalate, butyl phthalyl butyl glycolate, glycerin triacetin, and tributyrin. Additional suitable plasticizers include, e.g., pharmaceutical agent grade hydrocarbons such as mineral oil (e.g., light mineral oil) and petrolatum. Further suitable plasticizers include, e.g., triglycerides such as medium-chain triglyceride, soybean oil, safflower oil, peanut oil, and other pharmaceutical agent grade triglycerides, PEGylated triglycerides such as Labrifil®, Labrasol® and PEG-4 beeswax, lanolin, polyethylene oxide (PEO) and other polyethylene glycols, hydrophobic esters such as ethyl oleate, isopropyl myristate, isopropyl palmitate, cetyl ester wax, glyceryl monolaurate, and glyceryl monostearate.
One or more disintegration aids can optionally be employed to increase the disintegration rate and shorten the residence time of the device of the present invention. Disintegration aids useful in the present invention include, e.g., hydrophilic compounds such as water, methanol, ethanol, or low alkyl alcohols such as isopropyl alcohol, acetone, methyl ethyl acetone, alone or in combination. Specific disintegration aids include those having less volatility such as glycerin, propylene glycol, and polyethylene glycol.
One or more dissolution-rate-modifying agents can optionally be employed to decrease the disintegration rate and lengthen the residence time of the device of the present invention. Dissolution-rate modifying agents useful in the present invention include, e.g., hydrophobic compounds such as heptane, and dichloroethane, polyalkyl esters of di and tricarboxylic acids such as succinic and citric acid esterified with C6 to C20 alcohols, aromatic esters such as benzyl benzoate, triacetin, propylene carbonate and other hydrophobic compounds that have similar properties. These compounds can be used alone or in combination in the device of the invention.
The devices of the present invention can include various forms. For example, the device can be a disc or film. In one embodiment, the device comprises a mucoadhesive disc. In one embodiment of the methods and devices of the present invention, the device is a layered, flexible device. The thickness of the device of the present invention, in its form as a solid film or disc, may vary, depending on the thickness of each of the layers. Typically, the bilayer thickness ranges from about 0.01 mm to about 1 mm, and more specifically, from about 0.05 mm to about 0.5 mm. The thickness of each layer can vary from about 10% to about 90% of the overall thickness of the device, and specifically can vary from about 30% to about 60% of the overall thickness of the device. Thus, the preferred thickness of each layer can vary from about 0.005 mm to about 1.0 mm, and more specifically from about 0.01 mm to about 0.5 mm.
In one embodiment, the mucoadhesive polymeric diffusion environment of the device of the present invention has a thickness of about 0.03 mm to about 0.07 mm. In one embodiment, the mucoadhesive polymeric diffusion environment of the device of the present invention has a thickness of about 0.04 mm to about 0.06 mm. In yet another embodiment, the mucoadhesive polymeric diffusion environment of the present invention has a thickness of about 0.05 mm. The thickness of the mucoadhesive polymeric diffusion environment is designed to be thick enough so that it can be easily manufactured, yet thin enough to allow for maximum permeability of the medicament through the layer, and maximum absorption of the medicament into the mucosal layer.
In one embodiment, the backing layer of the device of the present invention has a thickness of about 0.050 mm to about 0.350 mm. In one embodiment, the backing layer of the device of the present invention has a thickness of about 0.100 mm to about 0.300 mm. In yet another embodiment, the backing layer of the present invention has a thickness of about 0.200 mm. The thickness of the backing layer is designed to be thick enough so that it allows for substantially unidirectional delivery of the medicament (towards the mucosa), yet thin enough to dissolve so that it does not have to be manually removed by the subject.
In these embodiments, there is relatively minimal mouth feel and little discomfort because of the thinness and flexibility of the devices as compared to conventional tablet or lozenge devices. This is especially advantageous for patients who have inflammation of the mucosa and/or who may otherwise not be able to comfortably use conventional devices. The devices of the present invention are small and flexible enough so that they can adhere to a non-inflamed area of the mucosa and still be effective, i.e., the mucosa does not need to be swabbed with the device of the present invention.
In various embodiments, the devices of the present invention can be in any form or shape such as a sheet or disc, circular or square in profile or cross-section, etc., provided the form allows for the delivery of the active to the subject. In some embodiments, the devices of the present invention can be scored, perforated or otherwise marked to delineate certain dosages. For example, a device may be a square sheet, perforated into quarters, where each quarter comprises a 200 μg dose. Accordingly, a subject can use the entire device for an 800 μg dose, or detach any portion thereof for a 200 μg, 400 μg or 600 μg dose.
The devices of the present invention can be adapted for any mucosal administration. In some embodiments of the methods and devices of the present invention, the device is adapted for buccal administration and/or sublingual administration.
Yet another advantage of the devices of the present invention is the ease with which they are administered. With conventional devices, the user must hold the device in place, or rub the device over the mucosa for the duration of administration, which may last from twenty to thirty minutes or more. The devices of the present invention adhere to the mucosal surface in less than about five seconds, and naturally erode in about twenty to thirty minutes, without any need to hold the device in place.
Without wishing to be bound by any particular theory, it is also believed that the devices of the present invention are substantially easier to use than devices of the prior art. When devices of the prior art are used, they are often subject to much variability, e.g., due to variation in mouth size, diligence of the subject in correctly administering the device and amount of saliva produced in the subject's mouth. Accordingly, in some embodiments, the present invention provides a variable-free method for treating pain in a subject. The term “variable-free” as used herein, refers to the fact that the devices of the present invention provide substantially similar pharmacokinetic profile in all subjects, regardless of mouth size and saliva production.
Without wishing to be bound by any particular theory, it is also believed that the presence of a backing layer also imparts a resistance to the devices of the present invention. Accordingly, in some embodiments, the devices of the present invention are resistant to the consumption of food or beverage. That is, the consumption of food or beverage while using the devices of the present invention does not substantially interfere with the effectiveness of the device. In some embodiments, the performance of the devices of the present invention, e.g., peak fentanyl concentrations and/or overall exposure to the medicament is unaffected by the consumption of foods and/or hot beverages.
In various embodiments, the devices can have any combination of the layers, ingredients or compositions described herein including but not limited to those described above.
EXEMPLIFICATION
Example 1: Preparation of Devices in Accordance with the Present Invention
Transmucosal devices were configured in the form of a disc, rectangular in shape with round corners, pink on one side and white on the other side. The drug is present in the pink layer, which is the mucoadhesive polymeric diffusion environment, and this side is to be placed in contact with the buccal mucosa (inside the cheek). The drug is delivered into the mucosa as the disc erodes in the mouth. The white side is the non-adhesive, backing layer which provides a controlled erosion of the disc, and minimizes the oral uptake of the drug induced by constant swallowing, thus minimizing or preventing first pass metabolism. The mucoadhesive polymeric diffusion environment and backing layer are bonded together and do not delaminate during or after application.
The backing layer was prepared by adding water (about 77% total formulation, by weight) to a mixing vessel followed by sequential addition of sodium benzoate (about 0.1% total formulation, by weight), methylparaben (about 0.1% total formulation, by weight) and propylparaben (about 0.03% total formulation, by weight), citric acid (about 0.1% total formulation, by weight) and vitamin E acetate (about 0.01% total formulation, by weight), and sodium saccharin (about 0.1% total formulation, by weight). Subsequently, a mixture of the polymers hydroxypropyl cellulose (Klucel EF, about 14% total formulation, by weight) and hydroxyethyl cellulose (Natrosol 250L, about 7% total formulation, by weight) was added and stirred at a temperature between about 120 and 130° F., until evenly dispersed. Upon cooling to room temperature, titanium dioxide (about 0.6% total formulation, by weight) and peppermint oil (about 0.2% total formulation, by weight) were then added to the vessel and stirred. The prepared mixture was stored in an air-sealed vessel until it was ready for use in the coating operation.
The mucoadhesive polymeric diffusion environment was prepared by adding water (about 89% total formulation, by weight) to a mixing vessel followed by sequential addition of propylene glycol (about 0.5% total formulation, by weight), sodium benzoate (about 0.06% total formulation, by weight), methylparaben (about 0.1% total formulation, by weight) and propylparaben (about 0.03% total formulation, by weight), vitamin E acetate (about 0.01% total formulation, by weight) and citric acid (about 0.06% total formulation, by weight), red iron oxide (about 0.01% total formulation, by weight), and monobasic sodium phosphate (about 0.04% total formulation, by weight). After the components were dissolved, 800 μg fentanyl citrate (about 0.9% total formulation, by weight) was added, and the vessel was heated to 120 to 130° F. After dissolution, the polymer mixture [hydroxypropyl cellulose (Klucel EF, about 0.6% total formulation, by weight), hydroxyethyl cellulose (Natrosol 250L, about 1.9% total formulation, by weight), polycarbophil (Noveon AA1(about 0.6% total formulation, by weight), and carboxy methyl cellulose (Aqualon 7LF, about 5.124% total formulation, by weight)] was added to the vessel, and stirred until dispersed. Subsequently, heat was removed from the mixing vessel. As the last addition step, tribasic sodium phosphate and sodium hydroxide were added to adjust the blend to a desired pH. For example, about 0.6% total formulation, by weight of sodium hydroxide and about 0.4% total formulation, by weight of tribasic sodium phosphate can be added to the formulation. Batches were made having pHs of about 6, 7.25, and 8.5. The blend was mixed under vacuum for a few hours. Each prepared mixture was stored in an air-sealed vessel until its use in the coating operation.
The layers were cast in series onto a St. Gobain polyester liner. First, the backing layer was cast using a knife-on-a-blade coating method. The backing layer was then cured in a continuous oven at about 65 to 95° C. and dried. After two coating and drying iterations, an approximately 8 mil (203 to 213 micrometers) thick backing layer is obtained. Subsequently, the mucoadhesive polymeric diffusion environment was cast onto the backing layer, cured in an oven at about 65 to 95° C. and dried. The devices were then die-cut by kiss-cut method and removed from the casting surface.
Example 2: Study of Fentanyl Citrate Uptake in Humans for Delivery Devices of the Present Invention and a Commercially Available Delivery Device
The effect of system pH on the uptake of fentanyl citrate in three exemplary delivery devices of the present invention was evaluated, and compared to that observed in Actiq® Oral Transmucosal Fentanyl Citrate product (Cephalon, Inc., Salt Lake City, Utah), referred to herein as “OTFC”. A randomized, open-label, single-dose, four-period, Latin-square crossover study was conducted in 12 healthy volunteers. An Ethical Review Board approved the study and all subjects gave informed consent before participating. Bioanalytical work using a validated liquid chromatography/mass spectrometry/mass spectrometry (LC/MS/MS) method was performed by CEDRA Clinical Research, LLC (Austin, Tex.).
Twelve (9 male, 3 female) healthy volunteers ranging in age from 21 to 44 years were recruited for the instant study. Subjects tested were free from any significant clinical abnormalities on the basis of medical history and physical examination, electrocardiogram, and screening laboratories. Subjects weighed between about 50 kg and 100 kg and were within 15% of their ideal body weight based on Metropolitan Life tables for height and weight. Subjects were instructed to not consume alcohol, caffeine, xanthine, or foods/beverages containing grapefruit for 48 hours prior to the first dose of study medication and for the entire duration of the study. Subjects were also instructed not to use tobacco or nicotine containing products for at least 30 days prior to the first dose of medication. No subject had participated in any investigational drug study for at least 30 days prior to the instant study; had any significant medical condition either at the time of the study or in the past (including glaucoma and seizure disorders); had a positive drug screen; had used any concomitant medication other than oral contraceptives or acetaminophen for at least 72 hours prior to the first dose; or had a history of allergic reaction or intolerance to narcotics. Premenopausal women not using contraception or having a positive urine beta HCG test were excluded. Table 2, below, shows the demographics of the subjects included in this study.
TABLE 2
Subject Demographics (N = 12)
Age, years
Mean (standard deviation)
32 (7)
Median
31
Range
21-44
Gender, n (%)
Female
3 (25)
Male
9 (75)
Race, n (%)
Black
3 (25)
Caucasian
4 (33)
Hispanic
5 (42)
Height (cm)
Mean (standard deviation)
171.6 (9.3)
Median
172.0
Range
155.0-183.5
Weight (kg)
Mean (standard deviation)
70.5 (9.0)
Median
70.7
Range
52.0-86.5
The study consisted of a screening visit and a 9-day inpatient period during which each subject received single buccal transmucosal doses of each of the four study treatments with 48 hours separating the doses. The four study treatments, each including 800 μg of fentanyl citrate, were: the OTFC and devices prepared as described in Example 1 and buffered at a pH of about 6 (“device at pH 6”), a pH of about 7.25 (“device at pH 7.25”), and a pH of about 8.5 (“device at pH 8.5”).
Subject eligibility was determined at the screening visit, up to 21 days prior to entering the study facility. Subjects arrived at the study facility at 6:00 PM the day prior to dosing (day 0). Predose procedures (physical examination, clinical laboratory tests, electrocardiogram, and substance abuse screen) were performed. After an overnight fast of at least 8 hours, subjects received an oral dose of naltrexone at 6 AM. A standard light breakfast was served approximately 1 hour prior to study drug dosing. A venous catheter was placed in a large forearm or hand vein for blood sampling, and a pulse oximeter and noninvasive blood pressure cuff were attached. Subjects were placed in a semi-recumbent position, which they maintained for 8 hours after each dose.
Subjects received the first dose of drug at 8 AM on day 1 and subsequent doses at the same time on days 3, 5, and 7. Blood samples (7 mL) were collected in ethylenediaminetetraacetic acid (EDTA) for measurement of plasma fentanyl just prior to dose 1 and 5, 7.5, 10, 15, 20, 25, 30, 45, and 60 minutes, and 2, 3, 4, 8, 12, 16, 20, 24, and 48 hours after each dose. The 48-hour post dose sample was collected just prior to administration of the subsequent dose. A total of 511 mL of blood was collected over the study period for pharmacokinetic analysis. Samples were centrifuged and the plasma portion drawn off and frozen at −20° C. or colder.
Finger pulse oximetry was monitored continuously for 8 hours after each dose and then hourly for an additional four hours. If the subject's oxyhemoglobin saturation persistently decreased to less than 90%, the subject was prompted to inhale deeply several times and was observed for signs of decreased oxyhemoglobin saturation. If the oxyhemoglobin saturation value immediately increased to 90% or above, no further action was taken. If the oxyhemoglobin saturation remained below 90% for more than 1 minute, oxygen was administered to the subject via a nasal cannula. Heart rate, respiratory rate, and blood pressure were measured just prior to the dose, and every 15 minutes for 120 minutes, and at 4, 6, 8, and 12 hours post dose. Throughout the study, subjects were instructed to inform the study personnel of any adverse events.
Each subject received a single buccal dose of each of the 4 study treatments in an open-label, randomized crossover design. The measured pH on the three devices during the manufacturing process in accordance with Example 1 were 5.95 for the device at pH 6.0, 7.44 for the device at pH 7.25, and 8.46 for the device at pH 8.5. After subjects rinsed their mouths with water, the delivery devices of the present invention were applied to the oral mucosa at a location approximately even with the lower teeth. The devices were held in place for 5 seconds until the device was moistened by saliva and adhered to the mucosa membrane. After application, subjects were instructed to avoid rubbing the device with their tongues, as this would accelerate the dissolution of the device.
OTFC doses were administered according to the package insert. After each mouth was rinsed with water, the OTFC unit was placed in the mouth between the cheek and lower gum. The OTFC unit was occasionally moved from one side of the mouth to the other. Subjects were instructed to suck, not chew, the OTFC unit over a 15-minute period. To block the respiratory depressive effects of fentanyl, a 50 mg oral dose of naltrexone was administered to each subject at approximately 12 hours and 0.5 hours prior to each dose of study drug and 12 hours after study drug. Naltrexone has been shown not to interfere with fentanyl pharmacokinetics in opioid naïve subjects. Lor M, et al., Clin Pharmacol Ther; 77: P76 (2005).
At the end of the study, EDTA plasma samples were analyzed for plasma fentanyl concentrations using a validated liquid chromatography with tandem mass spectrophotometry (LC/MS/MS) procedure. Samples were analyzed on a SCIEX API 3000 spectrophotometer using pentadeuterated fentanyl as an internal standard. The method was validated for a range of 0.0250 to 5.00 ng/mL based on the analysis of 0.500 mL of EDTA human plasma. Quantitation was performed using a weighted (1/X2) linear least squares regression analysis generated from calibration standards.
Pharmacokinetic data were analyzed by noncompartmental methods in WinNonlin (Pharsight Corporation). In the pharmacokinetic analysis, concentrations below the limit of quantitation (<0.0250 ng/mL) were treated as zero from time-zero up to the time at which the first quantifiable concentration (Cfirst) was observed. Subsequent to Cfirst, concentrations below this limit were treated as missing. Full precision concentration data were used for all pharmacokinetic and statistical analyses. Cfirst was defined as the first quantifiable concentration above the pre-dose concentration because quantifiable data were observed in the pre-dose samples in some subjects. λz was calculated using unweighted linear regression analysis on at least three log-transformed concentrations visually assessed to be on the linear portion of the terminal slope. The t1/2 was calculated as the ratio of 0.693 to λz. Pharmacokinetic parameters were summarized by treatment using descriptive statistics. Values of tfirst, tmax, Cmax, and AUCinf of the three exemplary devices of the present invention were compared to OTFC using an analysis of variance (ANOVA) model and Tukey's multiple comparison test. Statistical analysis was performed using SAS (SAS Institute Inc.). Table 3, below, presents the fentanyl pharmacokinetics for all 4 treatments after a single dose.
TABLE 3
Pharmacokinetic Parameters of OTFC and Three
Formulations of BEMA Fentanyl Citrate
Device at pH 6
Device at pH 7.25
Device at pH 8.5
OTFC 800 μg
Fentanyl 800 μg
Fentanyl 800 μg
Fentanyl 800 μg
(N = 12)
(N = 12)
(N = 12)
(N = 12)
Mean
CV
Mean
CV
Mean
CV
Mean
CV
Parameter
(SD)
%
(SD)
%
(SD)
%
(SD)
%
tfirst (hr)
0.23
78.03
0.13
27.99
0.15
54.18
0.21
55.21
(0.18)
(0.04)
(0.08)
(0.11)
Cfirst
0.07
64.95
0.05
35.25
0.06
41.59
0.06
30.08
(ng/mL)
(0.05)
(0.02)
(0.02)
(0.02)
tmax (hr)
2.28
58.04
2.15
53.23
1.61
64.49
2.21
60.64
(1.32)
(1.14)
(1.04)
(1.34)
Cmax
1.03
24.19
1.40
35.12
1.67
45.07
1.39
29.44
(ng/mL)1
(0.25)
(0.49)
(0.75)
(0.41)
AUClast
9.04
39.01
12.17
35.19
12.98
43.04
11.82
38.37
(hr · ng/mL)
(3.53)
(4.28)
(5.59)
(4.54)
AUC0-24
7.75
32.48
10.43
28.74
11.38
37.78
10.18
31.44
(hr · ng/mL)
(2.52)
(3.00)
(4.30)
(3.20)
AUCinf
10.30
37.29
13.68
33.24
14.44
37.33
13.11
36.40
(hr · ng/mL)
(3.84)
(4.55)
(5.39)
(4.77)
% AUCextrap
12.15
68.40
11.53
59.33
11.72
58.96
10.31
43.49
(8.31)
(6.84)
(6.91)
(4.49)
λz (hr−1)
0.05
37.83
0.05
31.10
0.05
21.18
0.06
26.98
(0.02)
(0.02)
(0.01)
(0.02)
t1/2 (hr)
15.33
44.67
15.12
33.66
14.28
19.23
13.33
31.04
(6.85)
(5.09)
(2.75)
(4.14)
MRT
15.92
38.73
15.73
26.63
14.45
21.61
14.31
31.09
(6.17)
(4.19)
(3.12)
(4.45)
1Mean differences of BEMA fentanyl formulations and OTFC significantly different by ANOVA, p = 0.0304.
Abbreviations used herein are as follows: Cfirst is the first quantifiable drug concentration in plasma determined directly from individual concentration-time data; tfirst is the time to the first quantifiable concentration; Cmax is the maximum drug concentration in plasma determined directly from individual concentration-time data; tmax is the time to reach maximum concentration; λz is the observed elimination rate constant; t1/2 is the observed terminal elimination half-life calculated as ln(2)/λz; AUC0-24 is the area under the concentration-time curve from time zero to 24 hours post-dose; calculated using the linear trapezoidal rule and extrapolated using the elimination rate constant if quantifiable data were not observed through 24 hours; AUClast is the area under the concentration-time curve from time zero to the time of the last quantifiable concentration; calculated using the linear trapezoidal rule; AUCinf is the area under the concentration-time curve from time zero extrapolated to infinity, calculated as AUClast+Clast/λz; AUCextrap (%) is the percentage of AUCinf based on extrapolation; MRT is the mean residence time, calculated as AUMCinf/AUCinf, where AUMCinf is the area under the first moment curve (concentration-time vs. time), calculated using the linear trapezoidal rule form time zero to Tlast (AUMClast) and extrapolated to infinity. It should be noted that, because quantifiable data were observed in the pre-dose samples for some subjects, Cfirst was redefined as the first quantifiable concentration above the pre-dose concentration, which was set to zero in calculating mean fentanyl concentrations.
FIG. 1 illustrates the plasma fentanyl concentration from 0 to 48 hours post-dose for the OTFC dose and the doses provided by the three exemplary devices of the present invention. The device at pH 7.25 provided the highest peak concentrations of fentanyl of the three devices of the present invention used in this study. In general, OTFC provided lower fentanyl concentrations for most time points as compared with the devices of the present invention. The device at pH 6 and the device at pH 8.5 yielded very similar concentration-time profiles, with Cmax values of 1.40 ng/mL and 1.39 ng/mL, respectively. These values are midway between the maximum plasma fentanyl values of 1.03 ng/mL for OTFC and 1.67 ng/mL for the device at pH 7.25. After approximately 6 hours post-dose, the fentanyl concentration-time profiles for the three devices of the present invention were similar. The differences in fentanyl Cmax values were statistically significant when comparing all of the devices of the present invention to OTFC (p=0.0304), and for pairwise comparisons of the device at pH 7.25 to OTFC (p<0.05).
In general, quantifiable fentanyl concentrations were observed earlier after administration of one of the three exemplary devices of the present invention (mean tfirst of 8 to 13 minutes) compared with OTFC (mean tfirst of 14 minutes). The device at pH 7.25 yielded the earliest average tmax (1.61 hours) and highest Cmax (mean 1.67 ng/mL). As shown in FIG. 2, fentanyl absorption from a device at pH 7.25 was more rapid over the first hour post dose than from OTFC, with 30-minute mean plasma concentrations of 0.9 ng/mL for the device at pH 7.25 and 0.5 ng/mL for OTFC.
The delivery devices of the present invention provided overall greater exposure to fentanyl, based on AUC0 24 as compared to OTFC. Fentanyl exposure as measured by AUC0-24 values, were similar across groups treated with one of the devices of the present invention, suggesting that comparable amounts of fentanyl enter the systemic circulation from each of the devices. The device at pH 7.25, however, demonstrated approximately 19% greater maximum plasma fentanyl concentration.
Overall, fentanyl concentrations were observed earlier and increased more rapidly after administration of a device of the present invention compared with OTFC. Mean 30 and 60 minute plasma fentanyl concentrations observed with use of the device at pH 7.25 were 1.8 and 1.7 times higher than with OTFC, respectively. Similarly, the maximum plasma fentanyl concentration was 60% higher using a device of the present invention (mean 1.67 ng/mL) when compared to use of OTFC (mean 1.03 ng/mL). The Cmax for OTFC identified in this study is nearly identical to the 1.1 ng/mL Cmax value reported by Lee and co-workers with both a single 800 mcg lozenge as well as two 400 mcg lozenges. Lee, M., et al., J Pain Symptom Manage 2003; 26:743-747. Overall, fentanyl exposure for the fentanyl formulations of the present invention were greater than for OTFC. Mean estimates of AUClast and AUCinf were slightly larger, but the same general trends were observed. This indicates that the transmucosal uptake is significantly improved in the devices of the present invention as compared to OTFC.
Mean t1/2 values and MRT values were similar for all treatment groups and the values in both cases followed the same trend. Additionally, because MRT after extravascular administration is dependent on the absorption and elimination rates, the MRT values suggest that fentanyl absorbs faster from a delivery device of the present invention, particularly with the device at pH 7.25 and the device at pH 8.5. This observation is consistent with the tmax for the delivery devices of the present invention relative to OTFC.
Adverse events were similar across treatment groups and confounded by the co-administration of naltrexone with each study treatment. The most frequent adverse events were sedation and dizziness. One subject experienced oral mucosal irritation with OTFC. No subject experienced mucosal irritation with any of the three exemplary devices of the present invention. All reported adverse events were mild or moderate in nature.
As demonstrated above, the delivery devices of the present invention provide significantly higher plasma fentanyl concentrations than OTFC. The delivery device at pH 7.25 appeared to provide enhanced uptake believed to be attributable to a favorable balance between drug solubility and ionization. Similar studies have shown that the delivery devices of the present invention provide an absolute bioavailability of about 70.5% and buccal absorption was about 51% (estimated by subtracting the AUCinf following an oral dose of fentanyl from the AUCinf following BEMA fentanyl applied to the buccal mucosa, dividing by the single disc BEMA Fentanyl AUCinf, and multiplying by 100).
Example 3: Preparation of Devices in Accordance with the Present Invention
Devices containing buprenorphine were also produced using the same method as described in Example 1, except that buprenorphine was added to the mucoadhesive polymeric diffusion environment, rather than fentanyl citrate.
Example 4: Study of Buprenorphine Uptake in Humans for Delivery Devices of the Present Invention
A study similar to that described in Example 2 was also performed with buprenorphine in exemplary devices of the present invention (at pH 6 and 7.25), suboxone sublingual and buprenex intramuscular. Results from this study are summarized in the graph in FIG. 3. As demonstrated in Table 4, the delivery devices of the present invention at pH 6 appeared to provide enhanced uptake believed to be attributable to a favorable balance between drug solubility and ionization.
TABLE 4
Pharmacokinetic data for buprenorphine
pH
6
7.25
tfirst (hr)
0.75
0.75
Cfirst (ng/mL)
0.0521
0.0845
tmax (hr)
3
3
Cmax (ng/mL)1
1.05
0.86
EQUIVALENTS
Numerous modifications and alternative embodiments of the present invention will be apparent to those skilled in the art in view of the foregoing description. Accordingly, this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the best mode for carrying out the present invention. Details of the structure may vary substantially without departing from the spirit of the invention, and exclusive use of all modifications that come within the scope of the appended claims is reserved. It is intended that the present invention be limited only to the extent required by the appended claims and the applicable rules of law.
All literature and similar material cited in this application, including, patents, patent applications, articles, books, treatises, dissertations and web pages, regardless of the format of such literature and similar materials, are expressly incorporated by reference in their entirety. In the event that one or more of the incorporated literature and similar materials differs from or contradicts this application, including defined terms, term usage, described techniques, or the like, this application controls.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described in any way.
While the present inventions have been described in conjunction with various embodiments and examples, it is not intended that the present teachings be limited to such embodiments or examples. On the contrary, the present inventions encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
The claims should not be read as limited to the described order or elements unless stated to that effect. It should be understood that various changes in form and detail may be made without departing from the scope of the appended claims. Therefore, all embodiments that come within the scope and spirit of the following claims and equivalents thereto are claimed.
|
15212912
|
biodelivery sciences international, inc.
|
USA
|
B2
|
Utility Patent Grant (with pre-grant publication) issued on or after January 2, 2001.
|
Open
|
|
|
Mar 30th, 2022 06:04PM
|
Mar 30th, 2022 06:04PM
|
BioDelivery Sciences
|
|
Pharmaceuticals & Biotechnology
|
|
nasdaq:bdsi
|
BioDelivery Sciences
|
Feb 27th, 2018 12:00AM
|
Dec 21st, 2012 12:00AM
|
https://www.uspto.gov?id=US09901539-20180227
|
Transmucosal drug delivery devices for use in chronic pain relief
|
Provided herein are methods for treating chronic pain by administering low doses of buprenorphine twice daily (or once daily) via a transmucosal drug delivery device. The methods and devices efficiently treat chronic pain without significant side effects.
|
9901539
|
1. A method of treating chronic pain, the method comprising:
administering to a subject in need thereof a mucoadhesive bioerodable drug delivery device, wherein the device is administered once or twice daily,
wherein the device comprises:
a bioerodable mucoadhesive layer comprising about 100 g to about 0.9 mg buprenorphine and buffered to a pH of between about 4.0 and about 6.0; and
a backing layer buffered to a pH of between about 4.0 and about 4.8 and that does not include an opioid antagonist;
wherein the device provides a steady-state Cmax of plasma buprenorphine concentration in a range between about 0.156 and about 0.364 ng/mL;
wherein the subject is an opioid-experienced subject; and
wherein the subject treated experiences mild or moderate common opioid adverse effects, or no common opioid adverse effects.
2. The method according to claim 1, wherein the device is administered once daily.
3. The method according to claim 1, wherein the chronic pain is chronic low back pain.
4. The method according to claim 1, wherein the chronic pain is moderate to severe chronic low back pain.
5. The method according to claim 1, wherein the subject is treated without significant constipation.
6. The method according to claim 1, wherein the subject is treated without significant nausea.
7. The method according to claim 1, wherein the total daily dose of buprenorphine administered to the subject is selected from the group consisting of 200 g, 220 g, 240 g, 280 g, 300 g, 320 g, 350 g, 360g, 400 g, 450 g, 480 g, 500 g, 550 g, 600 g, 620 g, 650 g, 700 g, 720 g, 750 g, 800 g, 860 g, 900 g, 960 g, 1000 g, 1100 g, 1200 g, 1250 g, 1300 g, 1400 g, 1500 g, 1600 g, and 1800 g of buprenorphine.
8. The method according to claim 1, wherein the mucoadhesive bioerodable drug delivery device further comprises a barrier layer comprising:
a polymeric barrier environment disposed adjacent to the mucoadhesive layer to provide a unidirectional gradient upon application to a mucosal surface for the rapid and efficient delivery of buprenorphine,
wherein the unidirectional gradient delivers buprenorphine across the buffered polymeric diffusion environment upon application to the mucosal surface.
9. A method of treating a subject with moderate to severe chronic low back pain, comprising:
administering to the subject twice daily a mucoadhesive bioerodable drug delivery device to an oral mucosal surface of the subject, the device comprising:
a bioerodable mucoadhesive layer comprising an effective amount of buprenorphine disposed in a buffered polymeric diffusion environment, wherein the polymeric diffusion environment is a buffered environment having a pH of between about 4 and about 6; and
a backing layer buffered to a pH between about 4.0 and about 4.8 and that does not include an opioid antagonist;
wherein the total daily dose of buprenorphine administered to the subject is effective for treating moderate to severe chronic low back pain;
wherein the subject is an opioid-experienced subject; and
wherein the subject treated experiences mild or moderate common opioid adverse effects, or no common opioid adverse effects.
10. The method according to claim 1, wherein said chronic pain is neuropathic pain.
11. The method according to claim 1, wherein said chronic pain is osteoarthritic pain.
12. The method according to claim 1, wherein the device comprises a dose of buprenorphine selected from the group consisting of 100 g, 110 g, 120 g, 140 g, 150 g, 160 g, 175 g, and 180g.
13. The method according to claim 1, wherein the total daily dose of buprenorphine administered to the subject ranges from 200 g to about 1800 μg.
14. The method according to claim 1, wherein steady-state Tmax of buprenorphine is in a range between about 2.00 and about 2.90 h.
15. The method according to claim 1, wherein Cmin of buprenorphine is in a range between about 0.0157 and about 0.0862 ng/mL.
16. The method according to claim 1, wherein steady-state AUClast of buprenorphine is in a range between about 0.4085 and about 5.033 h*ng/mL.
17. The method according to claim 1, wherein between about 2.4-6.9% of subjects experience drug related mild or moderate headaches as a treatment emergent adverse event (TEAE).
18. The method according to claim 1, wherein between about 3-6.9% of subjects experience drug related mild or moderate dizziness as a TEAE.
19. The method according to claim 1, wherein between about 2.6-27.9% of subjects experience drug related mild or moderate nausea as a TEAE.
20. The method according to claim 1, wherein between about 1.5-8.5% of subjects experience drug related mild or moderate constipation as a TEAE.
21. The method according to claim 1, wherein between about 0.9-3% of subjects experience drug related mild or moderate vomiting as a TEAE.
22. The method according to claim 1, wherein between about 7.7-33.9% of subjects experience drug related mild or moderate TEAEs.
|
22
|
RELATED APPLICATIONS
This application claims priority to U.S. Provisional Application No. 61/578,755, filed Dec. 21, 2011. The entire contents of this application are incorporated herein by reference.
This application is related to U.S. patent application Ser. No. 08/734,519, filed on Oct. 18, 1996, now U.S. Pat. No. 5,800,832, issued Sep. 1, 1998; U.S. patent application Ser. No. 09/144,827, filed on Sep. 1, 1998, now U.S. Pat. No. 6,159,498, issued on Dec. 12, 2000; U.S. patent application Ser. No. 11/069,089, filed on Mar. 1, 2005, now U.S. Pat. No. 7,579,019, issued on Aug. 25, 2009; U.S. patent application Ser. No. 11/639,408, filed on Dec. 13, 2006; U.S. patent application Ser. No. 11/817,915, filed on Sep. 6, 2007; U.S. patent application Ser. No. 13/834,306, filed on Jul. 15, 2011, now U.S. Pat. No. 8,147,866, issued on Apr. 3, 2012; U.S. patent application Ser. No. 13/590,094, filed on Aug. 20, 2012, the entire contents of which are incorporated herein by reference.
BACKGROUND
Chronic pain is pain that persists beyond the expected healing time, if resulting from injury, and can progress from a bothersome nuisance to a profound affliction. Chronic pain can cause a marked alteration in behavior with depression and anxiety, restriction in daily activities and excessive use of medication and medical services in an afflicted individual. The treatment of chronic pain is difficult, often inadequate and associated with high economic and psychological cost.
Buprenorphine is a partial μ-opiate receptor agonist, an ORL1/nociceptin receptor agonist with high affinity and a slow dissociation rate and a κ-opiate receptor antagonist.
Buprenorphine is metabolized by the liver, via the CYP3A4 isozyme of the cytochrome P450 enzyme system, into norbuprenorphine (by N-dealkylation) and other metabolites. Buprenorphine has a low oral bioavailability due to very high first-pass metabolism.
Buprenorphine is an analgesic, available commercially as Temgesic® 0.2 mg sublingual tablets, and as Buprenex® in a 0.3 mg/ml parenteral formulation. Buprenorphine is also available as a sublingual preparation (Subutex®) and as a sublingual abuse-resistant formulation with naloxone (Suboxone®). The FDA approved Suboxone/Subutex in 2002 as a treatment of opioid dependence. Sublingual buprenorphine has been used for opioid detoxification and maintenance.
A recent open-label study used sublingual buprenorphine (Suboxone®) for the treatment of chronic pain to those chronic opioid users (Malinoff et al., 2005, American Journal of Therapeutics 12, 379-384). Patients were treated with daily buprenorphine doses that ranged from 2-20 mg (mean 8 mg). The treatment lasted from 2.4 months to 16.6 months (mean 8.8 months). The article reports that patients experienced improvement in their condition and reported a decrease in their sensation of pain.
Still, effective methods for treating chronic pain that are not associated with adverse effects are needed, especially to those opioid naive or opioid experienced patients.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic representation of the design of a clinical study for evaluating the efficacy and safety of twice daily administration of BEMA buprenorphine in subjects with chronic low back pain.
FIG. 2 is a schematic representation of disposition of subjects who participated in the clinical study to evaluate the efficacy and safety of twice daily administration of BEMA buprenorphine in subjects with chronic low back pain.
FIG. 3 is a graph showing mean change from baseline in daily pain intensity experienced by the subjects with chronic low back pain after twice daily administration of BEMA buprenorphine.
SUMMARY OF THE INVENTION
The present teachings provide methods for treating chronic pain by administering low doses of buprenorphine twice daily (or once daily) via a mucoadhesive bioerodable drug delivery device. The methods and devices efficiently treat chronic pain without significant side effects, for example, less than 15% (preferably less than 10%, more preferably less than 5%) patients experience constipation.
The devices comprise about 100 μg to 0.9 mg buprenorphine, and provide steady-state Cmax of plasma buprenorphine concentration in a range between about 0.1 and about 1.2 ng/mL, such that the subject is treated for chronic pain.
In one embodiment, the buprenorphine delivery device comprises a bioerodable mucoadhesive layer comprising a therapeutically effective amount of buprenorphine disposed in a buffered polymeric diffusion environment, wherein the polymeric diffusion environment is a buffered environment having a pH of between about 4 and about 6. In another embodiment, the buprenorphine delivery device further comprises a bather layer comprising a polymeric barrier environment disposed adjacent to the mucoadhesive layer to provide a unidirectional gradient upon application to a mucosal surface for the rapid and efficient delivery of buprenorphine, wherein the unidirectional gradient delivers buprenorphine across the buffered polymeric diffusion environment upon application to the mucosal surface. In still another embodiment, the device comprises a mucoadhesive layer comprising an effective amount of buprenorphine buffered to a pH of between about 4.0 and about 6.0, and a backing layer buffered to a pH between about 4.0 and about 4.8.
In one embodiment, the device comprises about 120 μg to 0.9 mg buprenorphine.
The methods and devices disclosed therein can be used to treat a subject with chronic low back pain, such as moderate to severe chronic low back pain, or a subject with neuropathic pain or osteoarthritic pain.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides methods of treating chronic pain with low doses of buprenorphine. The present method of treating pain is also associated with lack of significant opioid adverse effects. For example, the subject is treated without experiencing any severe common opioid adverse effects. Or, the subject is treated experiencing mild or moderate common opioid adverse effects, or no common opioid adverse effects.
The present invention also provides effective chronic pain relief with twice daily administration of buprenorphine. The present invention is based, at least in part, on the surprising discovery that a transmucosal drug delivery device containing low doses of buprenorphine can be administered twice daily to opioid experienced subjects for effective management and relief of chronic pain, such as chronic low back pain. The present invention is also based on the discovery that this therapy does not result in substantial side effects associated with opioids, such as constipation and nausea.
Definitions
The following definitions are provided as guidance as to the meaning of certain terms used herein.
As used herein, the articles “a” and “an” mean “one or more” or “at least one,” unless otherwise indicated. That is, reference to any element of the present invention by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present.
As used herein, the term “acute pain” refers to pain characterized by a short duration, e.g., three to six months. Acute pain is typically associated with tissue damage, and manifests in ways that can be easily described and observed. It can, for example, cause sweating or increased heart rate. Acute pain can also increase over time, and/or occur intermittently.
As used herein, the term “bioavailability” is as defined in 21 CFR Section 320.1 and refers to the rate and extent to which the active ingredient or active moiety is absorbed from a drug product and becomes available at the site of action. The term “bioavailability”, “absolute bioavailability” or “total bioavailability” refers to the total bioavailability including amounts that are absorbed through the oral mucosal membrane (i.e., transmucosally) and through the GI mucosa of the lower GI tract. In some embodiments, the transmucosal drug delivery devices of the present invention provide bioavailability of buprenorphine of between 65% and 85%. In some embodiments, the bioavailability of buprenorphine is 80%.
As used herein, the term “bioequivalence” or “bioequivalent” is as defined in 21 CFR Section 320.1, and means the absence of a significant difference in the rate and extent to which the active ingredient or active moiety in pharmaceutical equivalents or pharmaceutical alternatives becomes available at the site of drug action when administered at the same molar dose under similar conditions in an appropriately designed study. The pharmacokinetic parameters Cmax and AUC for bioequivalent actives fall within the 80%-125% range of each other.
As used herein, the term “chronic pain” refers to pain which persists beyond the usual recovery period for an injury or illness. In one embodiment, chronic pain is the pain that lasts longer than one week. Chronic pain can be constant or intermittent. Common causes of chronic pain include, but are not limited to, arthritis, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), repetitive stress injuries, shingles, headaches, fibromyalgia, and diabetic neuropathy.
As used herein, the term “chronic low back pain” refers to a muscoskeletal disorder, wherein the subject experiences pain in the lumbar, or low back region for at least 12 weeks. In a specific embodiment, a subject experiences chronic low back pain for at least 3 months.
As used herein, the term “moderate to severe chronic low back pain” refers to the chronic low back pain characterized, e.g., by pain intensity of ≧5 on an 11-point Numerical Rating Scale (NRS, wherein 0 represents no pain and 10 represents the worst pain imaginable).
As used herein, the term “neuropathic pain” refers to a complex, chronic pain that usually is accompanied by tissue injury and results from lesions or diseases affecting the somatosensory system. With neuropathic pain, the nerve fibers themselves may be damaged, dysfunctional or injured. These damaged nerve fibers send incorrect signals to other pain centers. The impact of nerve fiber injury includes a change in nerve function both at the site of injury and areas around the injury.
As used herein, the term “osteoarthritic pain” refers to pain resulting from osteoarthritis, a degenerative joint disease and the most common type of arthritis. It is associated with the degradation and loss of a cartilage that covers and cushions the ends of bones in normal joints. Osteoarthritis causes the cartilage in a joint to become stiff and lose its elasticity, making it more susceptible to damage. Over time, the cartilage may wear away in some areas, greatly decreasing its ability to act as a shock absorber. As the cartilage wears away, tendons and ligaments stretch, causing pain. If the condition worsens, the bones could rub against each other, causing even more pain and loss of movement.
As used herein, unless indicated otherwise, the term “buprenorphine”, includes any pharmaceutically acceptable form of buprenorphine, including, but not limited to, salts, esters, and prodrugs thereof. As used herein, the term “buprenorphine derivative” refers to compounds having similar structure and function to buprenorphine. In some embodiments, buprenorphine derivatives include those of the following formula:
or pharmaceutically acceptable salts or esters thereof, wherein
is a double or single bond; R3 is selected from a —C1-4 alkyl group or a cycloalkyl-substituted-C1-4 alkyl group; R4 is selected from a —C1-4 alkyl; R5 is —OH, or taken together, R4 and R5 form a ═O group; and R6 is selected from —H or a —C1-4 alkyl group.
Buprenorphine derivatives include, but are not limited to, etorphine and diprenorphine. General buprenorphine derivatives are described in International Application Publication No. WO 2008/011194, which is hereby incorporated by reference.
As used herein, unless indicated otherwise, the term “naloxone” includes any pharmaceutically acceptable form of naloxone, including, but not limited to, salts, esters, and prodrugs thereof.
As used herein, “non-parenteral” refers to modes of administration other than by direct systemic delivery of the medicament. As such, “non-parenteral” excludes the use of intravenous (IV) injection, intramuscular (IM) injection, Intraperitoneal (IP) injection, subcutaneous (SC) injection, etc. for administration of the medicament and includes transdermal, oral transmucosal administration, and administration via the GI tract, generally.
As used herein, the term “mucoadhesive layer” or “polymeric diffusion environment” refers to an environment capable of allowing flux of a medicament to a mucosal surface upon creation of a gradient by adhesion to a mucosal surface. The flux of a transported medicament is proportionally related to the diffusivity of the environment which can be manipulated by, e.g., adjusting the pH, taking into account the ionic nature of the medicament and/or the ionic nature of the polymer or polymers included in the environment.
As used herein, the term “backing layer” or “barrier environment” or “non-adhesive polymeric environment” refers to an environment in the form of, e.g., a layer or coating or barrier layer, capable of slowing, or reducing flux of a medicament from the mucoadhesive layer into the oral cavity. In some embodiments, the backing layer may contain a second medicament intended for dissolution in the saliva. In such cases, the pH of the backing layer is adjusted, such that it impedes flux of the medicament toward the mucoadhesive layer where transmucosal absorption may occur. As used herein, the term “unidirectional gradient” refers to a gradient which allows for the flux of a medicament (e.g., buprenorphine) through the device, e.g., through a polymeric diffusion environment, in substantially one direction, e.g., to the oral mucosa of a subject. For example, the polymeric diffusion environment may be a mucoadhesive polymeric diffusion environment in the form of a layer or film disposed adjacent to a backing layer or film. Upon oral mucosal application, a gradient is created between the mucoadhesive polymeric diffusion environment and the mucosa, and the medicament flows from the mucoadhesive polymeric diffusion environment, substantially in one direction towards the mucosa, until the backing layer dissolves.
As used herein, “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of preventing, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder (e.g., to alleviate pain).
The term “subject” refers to living organisms such as humans, dogs, cats, and other mammals. Administration of the medicaments included in the devices of the present invention can be carried out at dosages and for periods of time effective for treatment of a subject. In some embodiments, the subject is a human. In some embodiments, the pharmacokinetic profiles of the devices of the present invention are similar for male and female subjects.
An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, the dosage may be administered once daily, or may be divided into two individual dosages for twice daily administration. The dose may also be proportionally reduced as indicated by the exigencies of the therapeutic situation.
The term “transmucosal,” as used herein, refers to any route of administration via a mucosal membrane. Examples include, but are not limited to, buccal, sublingual, nasal, vaginal, and rectal. In one embodiment, the administration is buccal. In one embodiment, the administration is sublingual. As used herein, the term “direct transmucosal” refers to mucosal administration via the oral mucosa, e.g., buccal and/or sublingual.
As used herein, the term “water erodable” or “at least partially water erodable” refers to a substance that exhibits a water erodability ranging from negligible to completely water erodable. The substance may readily dissolve in water or may only partially dissolve in water with difficulty over a long period of time. Furthermore, the substance may exhibit a differing erodability in body fluids compared with water because of the more complex nature of body fluids. For example, a substance that is negligibly erodable in water may show an erodability in body fluids that is slight to moderate. However, in other instances, the erodability in water and body fluid may be approximately the same.
As used herein, “addiction therapy” as related to a subject includes the administration of a drug to a subject with the purpose of reducing the cravings for the addictive substance.
As used herein, the term “opioid tolerance” refers to the phenomenon in which a subject is less susceptible to the effect of an opioid drug as a consequence of its prior administration. “Acute tolerance” describes tolerance that develops very rapidly following either a single dose or a few doses of opioids given over a short period of time. “Chronic tolerance” describes the observation that opioid administration over a longer period of time produces reduced effects. Associative tolerance is best expressed with low doses of opioids at long interdose intervals and is readily modified by behavioral or environmental interventions. Nonassociative tolerance is best expressed with high doses of drugs at short interdose intervals and is not modified by behavioral or environmental interventions.
As used herein, the term “opioid tolerant subject” refers to a subject currently receiving opioid therapy. In one embodiment, the subject is taking >60 mg oral morphine/day or equianalgesic dose of another opioid for 1 week or longer, as specified in the Table 1 below.
TABLE 1
Approximate
Opioid
Equianalgesic Oral Doses
Morphine
60 mg
Tramadol
300 mg
Hydromorphone
12 mg
Oxycodone
30 mg
Hydrocodone
30 mg
Oxymorphone
20 mg
Codeine
400 mg
As used herein, the term “opioid experienced subject” refers to a subject currently receiving opioid therapy. In one embodiment, the subject's daily use of opioids does not exceed the daily doses of opioids as specified in the Table 1 above.
As used herein, the term “opioid naive subject” refers to a subject who is not currently receiving opioid therapy. In one embodiment, the subject has not been exposed to opioids for 1 week or longer.
As used herein, the term “abusive” or “abusive manner” refers to uses of the devices beyond oral transmucosal administration such as by extracting the drug and injecting or snorting.
As used herein, the term “low dose of buprenorphine” refers to the daily dose less than 1.8 mg (e.g., about 200 μg to about 1800 μg, or about 240 μg to 1800 μg) of buprenorphine.
As used herein, the term “steady-state plasma concentration” refers to the state, wherein the fluctuation in plasma drug concentrations are the same or similar after each dose. The term “steady-state Cmax of plasma buprenorphine concentration” refers to the state, wherein the post dose maximum plasma concentration of buprenorphine does not differ from one dose to another. The term “steady-state Cmin of plasma buprenorphine concentration” refers to the state, wherein the post-dose minimum plasma concentration of buprenorphine does not differ from one dose to another. In one embodiment, the devices used in the present invention provide steady-state Cmax of plasma buprenorphine concentration in a range between about 0.1 and about 1.0 ng/mL. In another embodiment, the devices used in the present invention provide steady-state Cmax of plasma buprenorphine concentration in a range between about 0.1 and about 0.5 ng/mL.
As used herein, the term “common opioid adverse effects” refers to adverse effects commonly experienced by the subjects taking opioid analgesics. These common opioid adverse effects include, among others, headache, constipation, nausea or vomiting, pruritus, somnolence or cognitive impairment, dry mouth, tolerance or dependence and urinary retention.
The term “mild common opioid adverse effects” refers to adverse effects that do not require a special treatment and do not interfere with the subject's daily activities. The term “moderate common opioid adverse effects” refers to adverse effects that introduce a low level of inconvenience or concern to the subjects and could interfere with daily activities, but are usually ameliorated by simple therapeutic measures. The term “severe common opioid adverse effects” refers to adverse effects that interrupt usual daily activity and typically require systemic drug therapy or other treatment.
The term “significant constipation” refers to chronic or severe constipation associated with the continuous use of morphine or other opioids.
The term “significant nausea” refers to a severe condition of nausea that is commonly known in the art. In some embodiments, the term “significant nausea” is defined with a visual analog scale (VAS) score of greater than or equal to 25 mm on a 0 to 100 mm scale.
As used herein, the term “disposed” refers to the uniform or non-uniform distribution of an element within another.
Pain Management
Certain aspects of the present invention include methods for providing pain management and/or relief to a subject in need thereof. The pain can be any pain known in the art, caused by any disease, disorder, condition and/or circumstance and can be chronic pain or acute pain. Chronic pain can arise from many sources including, cancer, Reflex Sympathetic Dystrophy Syndrome (RSDS), and migraine. Acute pain is typically directly related to tissue damage, and lasts for a relatively short amount of time, e.g., hours to days, or up to 7 days. In other embodiments, the pain is breakthrough cancer pain.
In some aspects, the present invention provides methods of managing or treating chronic pain in a subject. In some embodiments, the subject is opioid experienced, opioid tolerant or opioid naive, as defined above. In a specific embodiment, the subject is opioid tolerant. In another embodiment, the subject has not responded to previous treatment with the maximal doses of non-steroidal anti-inflammatory drugs.
In some embodiments, the chronic pain is chronic lower back pain (CLBP). In some embodiments, the chronic lower back pain is moderate to severe chronic lower back pain. In other embodiments, the pain is neuropathic pain or osteoarthritic pain. In a specific embodiment, the subject to be treated for moderate to severe chronic low back pain is an opioid experienced subject.
It has also been presently found that twice daily (or once daily) administration of low doses of buprenorphine via transmucosal drug delivery devices of the present invention is associated with low incidence or absence of common opioid adverse effects associated with opioid analgesics. In one embodiment, the adverse effect is nausea. In another embodiment, the adverse effect is constipation.
Administration and Dosing of Buprenorphine
In some embodiments, transmucosal drug delivery devices of the present invention (e.g., BEMA Buprenorphine) are administered once daily or twice daily. In some embodiments, the total daily dose of buprenorphine administered is between 200 μg and 1800 μg, e.g., 200 μg, 220 μg, 240 μg, 280 μg, 300 μg, 320 μg, 350 μg, 360 μg, 400 μg, 450 μg, 480 μg, 500 μg, 550 μg, 600 μg, 620 μg, 650 μg, 700 μg, 720 μg, 750 μg, 800 μg, 860 μg, 900 μg, 960 μg, 1000 μg, 1100 μg, 1200 μg, 1250 μg, 1300 μg, 1400 μg, 1500 μg, 1600 μg, and 1800 μg.
In some embodiments, the transmucosal drug delivery devices of the present invention comprise low doses of buprenorphine. In one embodiment, the low dose of buprenorphine contained in the devices is defined as the dose of about 100 μg to about 900 μg of buprenorphine. In some embodiments, the low dose of buprenorphine comprised in the mucoadhesive device of the invention is 100 μg, 110 μg, 120 μg, 140 μg, 150 μg, 160 μg, 175 μg, 180 μg, 200 μg, 225 μg, 240 μg, 250 μg, 275 μg, 300 μg, 310 μg, 325 μg, 350 μg, 360 μg, 375 μg, 400 μg, 430 μg, 450 μg, 480 μg, 500 μg, 550 μg, 600 μg, 625 μg, 650 μg, 700 μg, 750 μg, 800 μg, 900 μg, 1000 μg, 1200 μg, 1250 μg, 1300 μg, 1400 μg, 1500 μg, 1600 μg, and 1800 μg.
Transmucosal Pharmaceutical Delivery Device
Preparation of transmucosal pharmaceutical delivery devices have been previously described, e.g., in U.S. patent application Ser. No. 08/734,519, filed on Oct. 18, 1996, now U.S. Pat. No. 5,800,832, issued Sep. 1, 1998; U.S. patent application Ser. No. 09/144,827, filed on Sep. 1, 1998, now U.S. Pat. No. 6,159,498, issued on Dec. 12, 2000; U.S. patent application Ser. No. 11/069,089, filed on Mar. 1, 2005, Now U.S. Pat. No. 7,579,019, issued on Aug. 25, 2009; U.S. patent application Ser. No. 11/639,408, filed on Dec. 13, 2006, published as US 2007/0148097; U.S. patent application Ser. No. 11/817,915, filed on Sep. 6, 2007, published as US 2010/0015183; U.S. patent application Ser. No. 13/834,306, filed on Jul. 15, 2011, now U.S. Pat. No. 8,147,866, issued on Apr. 3, 2012; U.S. patent application Ser. No. 13/590,094, filed on Aug. 20, 2012; U.S. patent application Ser. No. 12/537,571, filed on Aug. 7, 2009, published as US 2011/0033541; and U.S. patent application Ser. No. 12/537,580, filed on Aug. 7, 2009, published as US 2011/0033542, the entire contents of which are incorporated herein by reference.
i. Mucoadhesive Layer
In some embodiments, the devices of the present invention adhere to a mucosal surface of the subject within about 5 seconds following application. In some embodiments, the devices of the present invention comprise an opioid agonist. In some embodiments, the devices of the present invention include a bioerodable- or water-erodable mucoadhesive layer, and the opioid agonist is comprised in the mucoadhesive layer. In one embodiment, the opioid agonist is buprenorphine. The dose of buprenorphine that can be incorporated into the device of the present invention depends on the desired treatment dosage to be administered and can range from about 20 μg to about 20 mg, or from about 120 μg to about 2000 μg of buprenorphine.
ii. Backing Layer
In some embodiments, the device further comprises at least one additional non-adhesive polymeric environment, e.g., a backing layer. This layer is disposed adjacent to the mucoadhesive polymeric diffusion environment, e.g., a backing layer, functions to facilitate the delivery of the opioid agonist, such as buprenorphine, to the mucosa. This additional layer may comprise the same or a different combination of polymers as the mucoadhesive polymeric diffusion environment or the non-adhesive polymeric diffusion environment.
In some embodiments, the backing layer includes an additional medicament, such as an opioid antagonist, to render the device of the invention abuse-resistant. In some embodiments, the opioid antagonist is naloxone. The dose of naloxone that can be incorporated into the backing layer of the device of the present invention can range from about 2.5 μg to about 5 mg of naloxone. In some embodiments, the amount of buprenorphine and the amount of naloxone disposed in the device are present in a ratio chosen such that the effect of buprenorphine is negated by naloxone if the mixture is injected or snorted. In some embodiments, the amount of buprenorphine and the amount of naloxone disposed in the device are present in a 4:1 w/w ratio.
EXEMPLIFICATION OF THE INVENTION
The invention will be further understood by the following examples. However, those skilled in the art will readily appreciate that the specific experimental details are only illustrative and are not meant to limit the invention as described herein, which is defined by the claims which follow thereafter.
Example 1
Preparation of the Devices of the Invention
Transmucosal devices are configured in the form of a disc, rectangular in shape with round corners, yellow on one or both sides of the cheek). Buprenorphine is present in the mucoadhesive layer, and this side is to be placed in contact with the buccal mucosa (inside the cheek). The drug is delivered into and across the mucosa as the disc erodes in the mouth. The non-adhesive, backing layer controls the rate erosion of the disc, and minimizes the amount of buprenorphine dissolved in saliva and ultimately swallowed, a pathway of lower absorption due first pass metabolism. The mucoadhesive polymeric diffusion layer and the backing layer are bonded together and do not delaminate during or after application.
The mucoadhesive layer for the transmucosal devices of the present invention comprising the desired dosage of buprenorphine is prepared by mixing purified water, propylene glycol (about 4.6% total formulation, by dry weight), sodium benzoate (about 0.5% total formulation, by dry weight), methylparaben (about 0.9% total formulation, by dry weight), propylparaben (about 0.2% total formulation, by dry weight), vitamin E acetate (about 0.06% total formulation, by dry weight), citric acid (about 0.5% total formulation, by dry weight), yellow iron oxide (about 0.5% total formulation, by dry weight), monobasic sodium phosphate (about 3.4% total formulation, by dry weight). The above ingredients are added sequentially to a mixing vessel. After the components are dissolved, buprenorphine HCl (about 1.3% total formulation, by dry weight) is added, and the vessel was heated to 120° F. to 130° F. After dissolution, the polymer mixture (hydroxypropyl cellulose (about 6.8% total formulation, by dry weight), hydroxyethyl cellulose (about 20.3% total formulation, by dry weight), polycarbophil (about 6.3% total formulation, by dry weight), and carboxy methyl cellulose (about 54.3% total formulation, by dry weight)) are added to the vessel, and stirred until dispersed. Subsequently, heat is removed from the mixing vessel. As the last addition step, tribasic sodium phosphate and sodium hydroxide are added to adjust the blend to a desired pH. The blend is mixed under vacuum for a few hours. Each prepared mixture is stored in an air-sealed vessel until its use in the coating operation.
The backing layer is prepared by adding purified water to a mixing vessel followed by sequential addition of sodium benzoate (about 0.5% total formulation, by dry weight), methylparaben (about 0.4% total formulation, by dry weight), propylparaben (about 0.1% total formulation, by dry weight), citric acid (about 0.5% total formulation, by dry weight), vitamin E acetate (about 0.05% total formulation, by dry weight), sodium saccharin (about 0.5% total formulation, by dry weight). Subsequently, a mixture of the polymers hydroxypropyl cellulose (about 63% total formulation, by dry weight) and hydroxyethyl cellulose (about 32% total formulation, by dry weight) are added and stirred at a temperature between about 120° F. and 130° F., until evenly dispersed. Upon cooling to room temperature, titanium dioxide (about 2.5% total formulation, by dry weight) and peppermint oil (about 0.8% total formulation, by dry weight) are then added to the vessel and stirred. The prepared mixture is stored in an air-sealed vessel until it is ready for use in the coating operation.
The layers are cast in series onto a St. Gobain polyester liner. First, the backing layer is cast using a knife-on-a-blade coating method. The backing layer is then cured in a continuous oven at about 65° C. to 95° C. and dried. After two coating and drying iterations, an approximately 8 mil (203 to 213 micrometers) thick backing layer is obtained. Subsequently, the mucoadhesive polymeric diffusion environment is cast onto the backing layer, cured in an oven at about 65° C. to 95° C. and dried. The devices are then die-cut by kiss-cut method and removed from the casting surface.
Example 2
Placebo-Controlled, Double-Blind Study to Evaluate the Efficacy of BEMA Buprenorphine in Subjects with Moderate to Severe Chronic Low Back Pain
A 12-week, placebo-controlled, double-blind randomized withdrawal study was conducted to evaluate the efficacy and safety of buprenorphine delivered twice daily via transmucosal drug delivery device with enhanced uptake (BEMA buprenorphine) in subjects with moderate to severe chronic low back pain. The study was also designed to define the range of BEMA Buprenorphine doses effective for management of moderate to severe chronic lower back pain.
i. Study Design
The study consisted of an open-label dose titration period lasting up to 4 weeks, followed by a randomized, double-blind, placebo-controlled treatment period of 12 weeks. The subjects continued on their current pain therapy during the initial screening period (days −14 to −1) and until 12 to 24 hours prior to Day 0/1 of the open-label dose titration period. Predose assessments were performed on open-label titration period Day 0 and the first dose of study drug was taken on open-label titration period Day 1.
During the open-label titration period, the subjects were administered BEMA Buprenorphine approximately every 12 hours, and dose adjustments were performed at intervals over a period of up to 4 weeks until a stabilized dose was found (i.e., the dose that provided meaningful pain relief and was well tolerated). The titration sequence of BEMA Buprenorphine is illustrated in the Table 4 below. The subjects for whom a stabilized dose could not be found were discontinued from the study.
TABLE 4
BEMA Buprenorphne Titration Schedule
Titration Sequence - BEMA Buprenorphine
Study Days
Low Dose (Q12 hours)
1
A
7 (±3 days)
2xA
14 (±3 days)
3xA
21 (±3 days)
4xA
The subjects for whom a stabilized dose was identified and who had taken that dose at least 12 times over the last 7 days entered a 12-week, double-blind treatment period, in which half of subjects received BEMA Placebo and half continued receiving BEMA Buprenorphine at the stabilized dose. Each subject's participation in the entire study lasted 19 weeks. The schematic showing the study design is shown in FIG. 1.
ii. Subject Population Used in the Study
The subjects who were selected for the inclusion in the study were opioid naive or opioid experienced, as defined earlier in this application. Opioid experienced subjects were subjects taking ≦60 mg oral daily dose of morphine or equianalgesic dose of another allowed opioid for 1 week or longer. Opioid naive subjects were not taking any opioids for 1 week or longer.
A total of 334 subjects entered the study, of which 332 subjects entered the 4-week open-label dose titration period. As 97 subjects discontinued intervention during the open-label titration period, a total of 235 subjects continued on to the 12-week double-blind treatment period. Of the 117 subjects who received BEMA Buprenorphine, 28 discontinued intervention, and 89 subjects completed the study. Of the 118 subjects who received placebo, 37 discontinued intervention, and 81 subjects completed the study. Subject disposition during the study is summarized in FIG. 2, and the characteristics of the population who participated in the study are summarized in the Table 5 below:
TABLE 5
Study Population Characteristics
Open Label
Double Blind
Titration
Treatment
Double Blind
BEMA
BEMA
Treatment
Buprenorphine
Buprenorphine
Placebo
Number of subjects
332
117
118
Mean Age (yrs.)
51
51
51
Women, n (%)
55.5
53
56
Opioid Naive (%)
62.7
62.4
69.5
Mean Pain Intensity at
7
Screening
Mean Pain Intensity at
NA
3.23
3.26
Baseline
iii. Analgesic Efficacy of BEMA Buprenorphine
Analgesic efficacy was assessed daily by having the subject record their average pain intensity over the past 24 hours on a scale of 0 to 10, where 0 represents no pain and 10 represents the worst pain imaginable (11-point Numerical Rating Scale, NRS). The mean change in daily pain intensity from baseline (CBL) to final visit during double blind treatment period is presented in Tables 6-12 below. Tables 6-8 present the mean change data for different subject groups, and Tables 9-12 present the mean change data for the subject groups treated with different doses of buprenorphine.
TABLE 6
Average Daily Pain Intensity - All Subjects
BEMA
Parameter
Buprenorphine
Placebo
Number of subjects
117
118
Primary Analysis, mean (SD)
Baseline
3.23 (1.19)
3.26 (1.22)
Final
3.59 (1.91)
3.77 (2.22)
Least Squares Mean Difference
0.35
0.51
Treatment comparison of
−0.16
Change from Baseline (CBL)
Beta Buprenorphine (CBL
BB) minus placebo
p-value
0.53
TABLE 7
Average daily pain intensity -opioid experienced subjects
BEMA
Parameter
Buprenorphine
Placebo
Number of subjects
44
36
Primary Analysis, mean (SD)
Baseline
3.50 (1.14)
3.43 (0.87)
Final
4.05 (2.04)
4.86 (2.03)
Least Squares Mean Difference
0.57
1.41
Treatment comparison of CBL
−0.84
BB minus placebo
p-value
0.067
TABLE 8
Average daily pain intensity in opioid naive subjects
BEMA
Parameter
Buprenorphine
Placebo
Number of subjects
73
82
Primary Analysis, mean (SD)
Baseline
3.07 (1.20)
3.19 (1.33)
Final
3.31 (1.78)
3.29 (2.1)
Least Squares Mean Difference
0.21
0.13
Treatment comparison of CBL
0.08
BB minus placebo
p-value
0.78
As shown in Table 7, the change from baseline in average daily pain score on BEMA Buprenorphine compared to placebo is nearly statistically significant in the opioid experienced population.
TABLE 9
Average daily pain intensity in subjects treated
with the daily dose of A μg of buprenorphine
BEMA
Buprenorphine
Parameter
Dose A mcg
Placebo
N
28
33
Primary Analysis, mean (SD)
Baseline
2.79 (1.51)
3.12 (1.38)
Final
3.58 (1.79)
2.88 (2.18)
Least Squares Mean Difference
0.72
−0.24
Treatment comparison of CBL
0.90
BB minus placebo
p-value
0.085
TABLE 10
Average daily pain intensity in subjects treated
with the daily dose of 2xA μg of buprenorphine
BEMA
Buprenorphine
Parameter
Dose 2xA mcg
Placebo
N
31
33
Primary Analysis, mean (SD)
Baseline
3.25 (1.13)
3.33 (1.12)
Final
3.23 (1.73)
4.04 (2.27)
Least Squares Mean Difference
−0.03
0.72
Treatment comparison of CBL
−0.74
BB minus placebo
p-value
0.17
TABLE 11
Average daily pain intensity in subjects treated
with the daily dose of 3xA μg of buprenorphine
BEMA
Buprenorphine
Parameter
Dose 3xA mcg
Placebo
N
22
31
Primary Analysis, mean (SD)
Baseline
3.43 (0.87)
3.48 (1.25)
Final
4.24 (2.48)
4.0 (2.23)
Least Squares Mean Difference
0.79
0.53
Treatment comparison of CBL
0.26
BB minus placebo
p-value
0.70
TABLE 12
Average daily pain intensity in subjects treated
with the daily dose of 4xA μg of buprenorphine
BEMA
Buprenorphine
Parameter
Dose 4xA mcg
Placebo
N
36
21
Primary Analysis, mean (SD)
Baseline
3.45 (1.09)
3.04 (1.05)
Final
3.69 (1.75)
4.27 (1.92)
Least Squares Mean Difference
0.29
1.13
Treatment comparison of CBL
−0.84
BB minus placebo
p-value
0.11
Graphed in FIG. 3 is the mean change from baseline in daily pain intensity for all subjects; all subjects receiving 2×A μg, 3×A μg, or 4×A μg, BEMA Buprenorphine; all opioid experienced subjects; and all opioid experienced subjects receiving 2×A μg, 3×A μg, or 4×A μg BEMA Buprenorphine.
iv. Incidence of Adverse Events
Adverse events (AE) were recorded for all subjects in the study. AE was defined as any untoward medical occurrence in a patient or clinical investigation subject administered a pharmaceutical product and which does not necessarily have a causal relationship with this treatment. The total number of adverse events recorded for both the open label titration and double blind treatment periods are listed in the Table 13 below.
TABLE 13
Total Treatment Emergent Adverse Events (TEAEs)
Open Label Titration
Double Blind Treatment
BEMA
BEMA
Buprenorphine,
Buprenorphine
Placebo
Adverse event profile
n (%)
n (%)
n (%)
Subjects with ≧1 AE
219 (66)
73 (62)
68 (58)
Subjects with ≧1 AE
6 (5)
3 (2)
causing
discontinuation
Discontinued due to
opioid withdrawal
Subjects with ≧1 SAE
1 (1)
0
AEs reported in >5%
of subjects
Nausea
108 (32)
11 (9)
10 (8)
Vomiting
20 (6)
6 (5)
4 (3)
Constipation
36 (11)
7 (6)
3 (2)
Dizziness
30 (9)
4 (3)
1 (1)
Headache
39 (12)
12 (10)
5 (4)
The intensity of AEs was characterized as mild, moderate, or severe as follows:
Mild: AEs that were transient, did not require a special treatment and did not interfere with the subject's daily activities.
Moderate: AEs that introduced a low level of inconvenience or concern to the subject and could interfere with daily activities, but were usually ameliorated by simple therapeutic measures.
Severe: AEs that interrupted a subject's usual daily activity and typically required systemic drug therapy or other treatment.
Table 14 below shows the number and percent of subjects who experienced TEAEs during the open label titration period involving 330 subjects, with all TEAEs characterized by event intensity and relationship to the study drug. Table 15 below shows analogous data for the double blind treatment period and buprenorphine treatment group involving 117 subjects. The maximum intensity ever recorded for each event and the drug relationship at that intensity were used to categorize adverse events. “Drug-related” category is listed as “R” and includes adverse events with investigator-assessed relation to drug of “probably” or “possibly”. “Non drug-related” category is listed as “NR”.
TABLE 14
TEAEs by Event Intensity and Drug Relationship During Open Label Titration Period.
AE Intensity and Drug Relationship
AE
Mild
Moderate
Severe
Not Reported
Overall
Profile
R n (%)
NR n (%)
R n (%)
NR n (%)
R n (%)
NR n (%)
R n (%)
NR n (%)
R n (%)
NR n (%)
No. of subject
49 (14.8)
52 (15.8)
63 (19.1)
34 (10.3)
12 (3.6)
10 (3.0)
0
0
124 (37.6)
96 (29.1)
with ≧1 TEAE
Constipation
23 (7.0)
4 (1.2)
5 (1.5)
1 (0.3)
3 (0.9)
0
0
0
31 (9.4)
5 (1.5)
Nausea
50 (15.2)
9 (2.7)
42 (12.7)
1 (0.3)
5 (1.5)
1 (0.3)
0
0
97 (29.4)
11 (3.3)
Vomiting
3 (0.9)
6 (1.8)
7 (2.1)
0
2 (0.6)
1 (0.3)
0
0
12 (3.6)
7 (2.1)
Dizziness
13 (3.9)
3 (0.9)
10 (3.0)
1 (0.3)
3 (0.9)
0
0
0
26 (7.9)
4 (1.2)
Headache
15 (4.5)
9 (2.7)
8 (2.4)
3 (0.9)
3 (0.9)
1 (0.3)
0
0
26 (7.9)
13 (3.9)
TABLE 15
TEAEs by Event Intensity and Drug Relationship During Double Blind Treatment Period.
AE Intensity and Drug Relationship
AE
Mild
Moderate
Severe
Not Reported
Overall
Profile
R n (%)
NR n (%)
R n (%)
NR n (%)
R n (%)
NR n (%)
R n (%)
NR n (%)
R n (%)
NR n (%)
No. of subject
9 (7.7)
24 (20.5)
11 (9.94)
23 (19.7)
1 (0.9)
5 (4.3)
0
0
21 (17.9)
52 (44.4)
with ≧1 TEAE
Constipation
3 (2.6)
0
4 (3.4)
0
0
0
0
0
7 (6.0)
0
Nausea
5 (4.3)
3 (2.6)
3 (2.6)
0
0
0
0
0
8 (6.8)
3 (2.6)
Vomiting
0
2 (1.7)
2 (1.7)
1 (0.9)
1 (0.9)
0
0
0
3 (2.6)
3 (2.6)
Dizziness
1 (0.9)
0
2 (1.7)
0
1 (0.9)
0
0
0
4 (3.4)
0
Headache
1 (0.9)
7 (0.6)
2 (1.7)
1 (0.9)
0
1 (0.9)
0
0
3 (2.6)
9 (7.7)
Example 3
Pharmacokinetic Profiles for BEMA Buprenorphine
Pharmacokinetic parameters for the BEMA Buprenorphine doses used in the treatment of chronic pain were determined in a separate, multiple dose study. BEMA Buprenorphine contained buprenorphine doses of 2×A μg, and 4×A μg. Each dose was administered twice daily for 3 days with serial blood samples collected. Selected pharmacokinetic parameters are shown in the Table 16 below.
TABLE 16
Selected Pharmacokinetic Parameters for BEMA Buprenorphine Buccal
Films comprising 1xA μg, 2xA μg, 3xA μg and 4xA μg buprenorphine
Pharmacokinetic Parameters
(Mean values)
1xA μg
2xA μg
3xA μg
4xA μg
Tmax (hr)
2.90
2.61
2.00
2.20
Cmax (ng/mL)
0.0766
0.156
0.216
0.364
Cmin (ng/mL)
0.0157
0.0371
0.0558
0.0862
Cavg (ng/mL)
0.0409
0.0805
0.113
0.195
AUC0-τ (hr*ng/mL)
0.4903
0.9658
1.358
2.343
AUClast (hr*ng/mL)
0.4085
0.7902
1.111
5.033
Tmax refers to the time to reach the steady-state Cmax of plasma buprenorphine concentration.
Cmax refers to the maximum concentration in plasma in steady-state.
Cmin refers to the minimum concentration in plasma in steady-state.
Cavg refers to the average concentration in plasma in steady-state.
AUC0-τ refers to the area under the plasma concentration time curve from time-zero through the dosing interval
AUClast refers to the area under the concentration-time curve from time-zero to the time of the last quantifiable concentration.
|
13724959
|
biodelivery sciences international, inc.
|
USA
|
B2
|
Utility Patent Grant (with pre-grant publication) issued on or after January 2, 2001.
|
Open
|
|
|
Mar 30th, 2022 06:04PM
|
Mar 30th, 2022 06:04PM
|
BioDelivery Sciences
|
|
Pharmaceuticals & Biotechnology
|
|
nasdaq:bdsi
|
BioDelivery Sciences
|
Oct 1st, 2013 12:00AM
|
Nov 17th, 2011 12:00AM
|
https://www.uspto.gov?id=US08546555-20131001
|
Cochleate compositions directed against expression of proteins
|
Disclosed herein are novel siRNA-cochleate and morpholino-cochleate compositions. Also disclosed are methods of making and using siRNA-cochleate and morpholino-cochleate compositions.
|
8546555
|
1. An siRNA-cochleate composition comprising:
a cochleate; and
an siRNA associated with the cochleate,
wherein the cochleate comprises a negatively charged lipid component and a multivalent cation component,
wherein the siRNA is complexed with polyethylenimine (PEI) prior to contacting a liposome.
2. The siRNA-cochleate composition of claim 1, wherein the siRNA comprises at least one mismatch.
3. The siRNA-cochleate composition of claim 1, wherein the siRNA comprises at least one substitution.
4. The siRNA-cochleate composition of claim 1, wherein the siRNA is about 21-23 nucleotides long.
5. The siRNA-cochleate composition of claim 1, wherein the siRNA mediates RNA interference against a target mRNA.
6. The siRNA-cochleate composition of claim 5, wherein the target mRNA expresses a protein selected from the group consisting of: a cancer protein, a virus protein, an HIV protein, a fungus protein, a bacterial protein, an abnormal cellular protein, a normal cellular protein.
7. The siRNA-cochleate composition of claim 1, further comprising a second siRNA directed against a second target mRNA.
8. The siRNA-cochleate composition of claim 1, further comprising at least one additional cargo moiety.
9. The siRNA-cochleate composition of claim 1, further comprising an aggregation inhibitor.
10. A method of forming an siRNA-cochleate composition comprising:
complexing an siRNA with
polyethylenimine (PEI);
contacting the complexed siRNA with a liposome; and
precipitating the liposome and the complexed siRNA to form an siRNA-cochleate composition,
wherein the cochleate comprises a negatively charged lipid component and a multivalent cation component.
11. The method of claim 10, comprising adjusting the pH of a liposomal suspension of the siRNA.
12. The method of claim 10, comprising charging the base pairs of the siRNA.
13. The method of claim 10, comprising using an elevated amount of calcium for precipitating the liposome and the siRNA.
14. The method of claim 10, comprising the step of extruding the liposome and the siRNA prior to precipitation.
|
14
|
RELATED APPLICATIONS
This application is a continuation of U.S. Ser. No. 12/658,636 filed Feb. 11, 2010, now abandoned, which, in turn, is a continuation of U.S. Ser. No. 11/653,093 filed Jan. 11, 2007, now abandoned, which, in turn, is a continuation of U.S. Ser. No. 10/822,235 filed Apr. 9, 2004, now abandoned, which claims the benefit of U.S. Provisional Application Ser. No. 60/463,076, filed Apr. 15, 2003; U.S. Provisional Application Ser. No. 60/502,557, filed Sep. 11, 2003; U.S. Provisional Application No. 60/499,247 filed Aug. 28, 2003; U.S. Provisional Application No. 60/532,755, filed Dec. 24, 2003. The entire contents of each of the aforementioned applications are hereby expressly incorporated herein by reference in their entireties.
BACKGROUND OF THE INVENTION
In diverse eukaryotes, double-stranded RNA (dsRNA) triggers the destruction of mRNA sharing sequence with the double-strand (Hutvdgner et al. (2002) Curr. Opin. Genet. Dev. 12:225-232; Hannon (2002) Nature 418:244-25 1). In animals and basal eukaryotes, this process is called RNA interference (RNAi) (Fire et al. (1998) Nature 391:806-811). There is now wide agreement that RNAi is initiated by the conversion of dsRNA into 21-23 nucleotide fragments by the multi-domain RNase III enzyme, Dicer (Bernstein et al. (2001) Nature 409:363-366; Billy et al. (2001) Proc. Natl. Acad. Sci. USA 98:14428-14433; Grishok et al. (2001) Cell 106:23-34; Ketting et al. (2001) Genes Dev. 15:2654-2659; Knight et al. (2001) Science 293:2269-2271; and Martens et al. (2002) Cell 13:445-453). These short RNAs are known as small interfering RNAs (siRNAs), and they direct the degradation of target RNAs complementary to the siRNA sequence (Zamore et al. (2000) Cell 101:25-33; Elbashir et al. (2001) Nature 411:494498; Elbashir et al. (2001) Genes Dev. 15:188-200; Elbashir et al. (2001) EMBO J 20:6877-6888; Nykdnen et al. (2001) Cell 107:309-321; and Elbashir et al. (2002) Clin. Pharmacol. 26:199-213).
siRNA molecules typically have 2- to 3-nucleotide 3′-overhanging ends, which permits them to be capable of interacting with an endonuclease complex, which results in a targeted mRNA cleavage. The potential therapeutic use of siRNA has been demonstrated in a number of systems. RNAi technology has been utilized to successfully target various genes, including HIV rev genes, CD4 and CD8 genes, and P53 genes (Lee, N. S. et al. (2002) Nature Biotechnol. 20: 500-505; Brummelkamp, T. R., et al. Science 2002. 296: 550-553.).
siRNAs have been used in a number of different experimental settings to silence gene expression. For example, chemically synthesized or in vivo transcribed siRNAs have been transfected into cells, injected into mice, or introduced into plants (e.g. by a particle gun). Additionally, siRNAs have been expressed endogenously from siRNA expression vectors or PCR products in cells or in transgenic animals. Besides being utilized for gene silencing, siRNAs have been determined to play diverse biological functions in vivo. This includes roles that include antiviral defense, transposon silencing, gene regulation, centromeric silencing, and genomic rearrangements. Such functional diversity has exemplified the importance of siRNAs within cells and has also stirred interest in their detection across species and tissues. Gene Specific Silencing by RNAi, Tech Notes 10(1). McManus M T and Sharp P A (2002) Gene silencing in mammals by small interfering RNAs. Nature Rev Genet 3: 737-747. Dillin A (2003) Proc Natl Acad Sci USA 100(11): 6289-6291. Tuschl T (2002) Nature Biotechnol 20: 446-448.
An obstacle to the realization of the full potential of gene therapy is the development of safe and effective means for delivering siRNA to cells and organisms. The use of antisense oligonucleotides as therapeutic agents has also been widely investigated in the past few years. Gould-Fogerite et al. Cochleate Delivery Vehicles: Applications to Gene Therapy. Drug Delivery Technology, Vol 3:40-47, 2003. Parker et al. In Vivo and in vitro anti-proliferative effects of antisense IL-10 Oligonucleotides in Antisense Technology, Part B, M. Ian Phillips, Ed., Methods in Enzymology, Vol 314, pp 411-429, 1999; Mannino et al., New Generation Vaccines: “Antigen cochleate formulations for oral and systemic vaccination,” p. 1-9 (Marcel Dekker, New York, 2nd ed. 1997); Brent et al., Neurosci 114(2): 275-278 (2002); Akhtar et al., Nucleic Acids Res. 19:5551 (1991). Their efficacy is based on their ability to recognize their mRNA target in the cytoplasm and to block gene expression by binding and inactivating selected RNA sequences.
While the potential of antisense is widely recognized, there are numerous limitations to the use of antisense currently available. One of the key limiting aspects of this strategy is poor cell penetration. Akhtar et al., Nucleic Acids Res. 19:5551 (1991).
Morpholino oligonucleotides (also referred to herein as “morpholinos”) are oligonucleotides that include an antisense oligonucleotide and morpholine backbone. These antisense morpholinos, typically 18-25 nucleotides in length, can be designed to bind to a complementary sequence in a selected mRNA. The binding of the morpholino to the “target sequence” prevents translation of that specific mRNA, thereby preventing the protein product from being made. Morpholinos function by an RNase H-independent mechanism (i.e., a steric block mechanism as opposed to an RNase H-cleavage mechanism), and are soluble in aqueous solutions, with most being freely soluble at mM concentrations (typically 10 mg/ml to over 100 mg/ml). Nasevicius et al., Nat. Genet 26:216-220 (2000); Lewis et al., Development 128:3485-95 (2001); Mang'era et al., Eur. J. Nucl. Med. 28:1682-1689 (2001); Satou et al., Genesis 30:103-06 (2001); Tawk et al., Genesis 32:27-31 (2002); Lebedeva et al., Annu. Rev. Pharmacol. Toxicol. 4:403-19 (2001).
Morpholinos have numerous, significant advantages over the alternative phosphorothioates, which have been documented with a number of non-antisense effects. Morpholinos generally are stable in cells because their morpholine backbone is not recognized by nucleases. In addition, morpholinos are highly effective with predictable targeting, as compared to other antisense molecules. Nasevicius et al., Nat. Genet 26:216-220 (2000); Lewis et al., Development 128:3485-95 (2001); Mang'era et al., Eur. J. Nucl. Med. 28:1682-1689 (2001); Satou et al., Genesis 30:103-06 (2001); Tawk et al., Genesis 32:27-31 (2002); Lebedeva et al., Annu. Rev. Pharmacol. Toxicol. 4:403-19 (2001).
Key parameters for antisense inhibition by antisense oligodeoxiribonucleotides are their intracellular delivery and concentration. At the present time, it is believed that naked oligonucleotides enter the cell via active processes of adsorptive endocytosis and pinocytosis. However, the penetration of the endosomal barrier is a pre-requisite event for antisense activity and the naked antisense oligonucleotides do not appear to do this in great extent. Lebedeva et al., Annu. Rev. Pharmacol. Toxicol. 4:403-19 (2001); Weiss et al., Neurochem. Int. 31:321-48 (1997). Although complexes of antisense oligonucleotides with cationic liposomes, in some instances, have enhanced intracellular delivery, they have come with a disadvantage, cytotoxicity. Their utility in vitro and in vivo has also been limited by their lack of stability in serum and their inflammatory properties.
Conventional methods for the delivery of morpholinos in vitro include scrape loading and the so-called “special delivery vehicles.” Scrape loading entails adding oligonucleotides to adherent cells and scraping the cells from their plate, which disrupts the cell membrane temporarily allowing the oligonucleotide to enter the cell cytoplasm. Scraping the cells causes damage to the membrane, thereby reducing the viability of the cell population and ultimately altering the cellular characteristics of the remaining viable cells. Of the cells that do survive, not all may have received the morpholino. The second method, the “special delivery vehicle” supplied with the morpholino, requires dramatic changes in pH that result in very low efficacy. The low efficacy of the “special delivery vehicle” may be due to cytotoxicity or other changes to the cells.
The above methods are not translatable to in vivo delivery because they involve compromise of the target cells and pH changes. Furthermore, any in vivo delivery method or product must deliver the oligonucleotide to the cytosol. Without delivery to the cytosol, oligonucleotides remain trapped in the endosome/lysosome, or may be exocytosed.
SUMMARY OF THE INVENTION
The present invention provides compositions and methods of delivering siRNA and morpholinos to cells and organisms employing cochleates. Also provided are novel methods of forming cochleates and methods of treatment and administration.
In one aspect, the invention provides an siRNA-cochleate composition including a cochleate, and an siRNA associated with the cochleate. In certain embodiments, the siRNA comprises at least one mismatch, at least one substitution, and/or is about 21-23 nucleotides long.
In one embodiment, the siRNA mediates RNA interference against a target mRNA. The target mRNA can be, e.g., an mRNA that expresses a protein selected from the group consisting of: a cancer protein, a virus protein, an HIV protein, a fungus protein, a bacterial protein, an abnormal cellular protein, a normal cellular protein. The composition can also include a second siRNA directed against a second target mRNA. In certain preferred embodiments, the composition includes a plurality of siRNA against the same target mRNA.
In one embodiment, the cochleate includes a negatively charged lipid component and a multivalent cation component. Additionally or alternatively, the siRNA is complexed with a transfection agent prior to contacting the liposomes. The transfection agent can be a polycationic transfection agent, e.g., polyethylenimine (PEI) or a derivative thereof. The compositions of the invention can further include at least one additional cargo moiety and/or at least one aggregation inhibitor.
In another aspect, the invention provides a method of administering an siRNA to a host comprising: administering a biologically effective amount of an siRNA-cochleate composition to a host comprising a cochleate and an siRNA associated with the cochleate. In one embodiment, the siRNA is delivered from the cochleate to a cell in the host. In another, the siRNA is delivered into a cytosol compartment of the cell.
In preferred embodiments, the siRNA mediates RNA interference against a target mRNA in the host. In one embodiment, the target mRNA expression in the host is reduced by at least about 50%. In other embodiments, the target protein synthesis in the host is reduced by at least about 10%, or at least about 50%. In certain embodiments, the host is a cell, a cell culture, an organ, tissue, or an animal. The method may also include the step of examining the function of the target mRNA or protein expressed by the target mRNA in the host.
In yet another aspect, the invention provides a method of treating a subject having a disease or disorder associated with expression of a target mRNA. The method includes administering to a subject a therapeutically effective amount of an siRNA-cochleate composition, including a cochleate and an siRNA against a target mRNA associated with a disease or disorder, such that the disease or disorder is treated.
In some embodiments, the disease or disorder is selected from the group consisting of: a neurological disorder associated with aberrant or unwanted gene expression, schizophrenia, obsessive compulsive disorder (OCD), depression, a bipolar disorder, Alzheimer's disease, Parkinson's disease, a lysosomal storage disease, Fabry's disease, Gaucher's Disease, Type I Gaucher's Disease, Farber's disease, Niemann-Pick disease (types A and B), globoid cell leukodystrophy (Krabbe's disease), metachromic leukodystrophy, multiple sulfatase deficiency, sulfatidase activator (sap-B) deficiency, sap-C deficiency, GM1-gangliosidosis, Tay-Sachs disease, Tay-Sachs B1 variant, Tay-Sachs AB variant, Acid Maltase Deficiency, Mucopolysaccharidosis, Sandhoff's disease, a cancer, a cell proliferative disorder, a blood coagulation disorder, Dysfibrinogenaemia, hemophelia (A and B), dematological disorders, hyperlipidemia, hyperglycemia, hypercholesterolemia, obesity, acute and chronic leukemias and lymphomas, sarcomas, adenomas, a fungal infection, a bacterial infection, a viral infection, an autoimmune disorder, systemic lupus erythematosis, multiple sclerosis, myasthenia gravis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, Grave's disease, allogenic transplant rejection, rheumatoid arthritis, ankylosing spondylitis, psoriasis, scleroderma, carcinomas, epithelial cancers, small cell lung cancer, non-small cell lung cancer, prostate cancer, breast cancer, pancreatic cancer, hepatocellular carcinoma, renal cell carcinoma, biliary cancer, colorectal cancer, ovarian cancer, uterine cancer, melanoma, cervical cancer, testicular cancer, esophageal cancer, gastric cancer, mesothelioma, glioma, glioblastoma, pituitary adenomas, inflammatory diseases, osteoarthritis, atherosclerosis, inflammatory bowel diseases (Crohns and ulcerative colitis), uveitis, eczema, chronic rhinosinusitis, asthma, a hereditary disease, cystic fibrosis, and muscular dystrophy.
In yet another aspect, the invention provides a method of forming an siRNA-cochleate composition that includes precipitating a liposome and an siRNA to form an siRNA-cochleate. In one embodiment, the method includes adjusting the pH of the siRNA and/or charging the base pairs of the siRNA.
In some embodiments, the siRNA is complexed with a transfection agent prior to precipitating. The transfection agent can be mixed with the liposomes prior to adding the siRNA. In one embodiment, the transfection agent is PEI or a derivative thereof or other polyvalent cation.
The method can include using an elevated amount of calcium for precipitating the liposome and the siRNA. Additionally or alternatively, the method can include the step of extruding the liposome with the siRNA prior to precipitation. In certain embodiments, the siRNA-liposome can be prepared by adding a chelating agent to a cochleate to form a liposome in the presence of siRNA.
In yet another aspect, the invention provides a morpholino-cochleate composition that includes a cochleate; and a morpholino oligonucleotide associated with the cochleate.
In one embodiment, the morpholino oligonucleotide is an antisense morpholino oligonucleotide. The morpholino oligonucleotide can include at least one mismatch and/or can be about 18-25 nucleotides long. In preferred embodiments, the morpholino oligonucleotide mediates inhibition of translation of a target mRNA. In preferred embodiments, the morpholino oligonucleotide is also directed against the synthesis of a protein.
In certain embodiments, the cochleate comprises a negatively charged lipid component and a cation component, includes at least one additional cargo moiety and/or includes at least one aggregation inhibitor. The composition can also include a second morpholino oligonucleotide directed against the synthesis of the protein or a second protein. In other embodiments, the composition includes a plurality of morpholinos directed against the same target mRNA.
In yet another aspect, the invention provides a method of administering a morpholino oligonucleotide to a host. The method generally includes administering a biologically effective amount of a morpholino-cochleate composition to the host comprising a cochleate and a morpholino oligonucleotide associated with the cochleate.
In one embodiment, the morpholino oligonucleotide is released from the cochleate into a cell in the host. In preferred embodiments, the morpholino oligonucleotide mediates inhibition of translation of a target mRNA.
In certain embodiments, target mRNA expression in the host is reduced by at least about 50%, target protein synthesis in the host is reduced by at least about 10%, and/or target protein synthesis in the host is reduced by at least about 50%.
In certain embodiments, the host is a cell, a cell culture, an organ, tissue, or an animal, and/or the morpholino oligonucleotide is delivered into a cytosol compartment of a cell.
In yet another aspect, the invention provides a method of forming a morpholino-cochleate composition that includes the step of precipitating a liposome and a morpholino to form a morpholino-cochleate.
The method can include the step of adjusting the pH of the morpholino and/or charging the base pairs of the morpholino. The method can include adjusting the pH of the morpholino to induce a charge in the morpholino. In one embodiment, the pH of the morpholino is between about 8.0 and about 9.0.
The method can include using an elevated amount of calcium for precipitating the liposome and the morpholino. The method can include extruding the liposome prior to precipitation. In one embodiment, the liposome is prepared from addition of a chelating agent to a cochleate to form a liposome in the presence of morpholino. In some embodiments, the method includes adding at least one additional cargo moiety to the morpholino and the liposome prior to or after precipitating and/or adding an aggregation inhibitor to the morpholino and the liposome prior to or after precipitating.
In yet another aspect, the invention provides a method of treating a subject having a disease or disorder associated with expression of a target mRNA. The method generally includes administering to a subject a therapeutically effective amount of an morpholino-cochleate composition, comprising a cochleate and an siRNA against a target mRNA associated with a disease or disorder, such that the disease or disorder is treated. The disease or disorder can be selected from the group consisting of: a neurological disorder associated with aberrant or unwanted gene expression, schizophrenia, obsessive compulsive disorder (OCD), depression, a bipolar disorder, Alzheimer's disease, Parkinson's disease, a lysosomal storage disease, Fabry's disease, Gaucher's Disease, Type I Gaucher's Disease, Farber's disease, Niemann-Pick disease (types A and B), globoid cell leukodystrophy (Krabbe's disease), metachromic leukodystrophy, multiple sulfatase deficiency, sulfatidase activator (sap-B) deficiency, sap-C deficiency, GM1-gangliosidosis, Tay-Sachs disease, Tay-Sachs B1 variant, Tay-Sachs AB variant, Acid Maltase Deficiency, Mucopolysaccharidosis, Sandhoff's disease, a cancer, a cell proliferative disorder, a blood coagulation disorder, Dysfibrinogenaemia, hemophelia (A and B), dematological disorders, hyperlipidemia, hyperglycemia, hypercholesterolemia, obesity, acute and chronic leukemias and lymphomas, sarcomas, adenomas, a fungal infection, a bacterial infection, a viral infection, an autoimmune disorder, systemic lupus erythematosis, multiple sclerosis, myasthenia gravis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, Grave's disease, allogenic transplant rejection, rheumatoid arthritis, ankylosing spondylitis, psoriasis, scleroderma, carcinomas, epithelial cancers, small cell lung cancer, non-small cell lung cancer, prostate cancer, breast cancer, pancreatic cancer, hepatocellular carcinoma, renal cell carcinoma, biliary cancer, colorectal cancer, ovarian cancer, uterine cancer, melanoma, cervical cancer, testicular cancer, esophageal cancer, gastric cancer, mesothelioma, glioma, glioblastoma, pituitary adenomas, inflammatory diseases, osteoarthritis, atherosclerosis, inflammatory bowel diseases (Crohns and ulcerative colitis), uveitis, eczema, chronic rhinosinusitis, asthma, a hereditary disease, cystic fibrosis, and muscular dystrophy.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A-D is photographs of cells treated with morpholino-cochleates. FIGS. 1A and 1B are photographs of rhodamine labeled cochleates incubated with NGF differentiated PC12 cells at 3 hours and 12 hours, respectively, after cochleate introduction. As illuminated by the fluoresced rhodamine, the cochleates fuse with the outer membrane and form submembrane aggregates. FIGS. 1C (low power) and 1D (high power) are photographs of fluoresced rhodamine labeled cochleates containing fluorescein isothiocyanate (FITC) labeled morpholinos. FIGS. 1C-D illustrate cochleates containing morpholinos, morpholinos that have been released into the cytosol from unwrapped cochleates and the delivery of FITC labeled anti-GAPDH Morpholino into the cytoplasm. Scale bars indicate 10 micrometers.
FIGS. 2A-B are photographs of X-Y RGCL LCSM computational slices demonstrating avid cochleate uptake by retinal ganglion cells in situ.
FIG. 3 includes two Western blots illustrating a decrease in glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein at 18 and 24 hours following treatment with a GAPDH antisense morpholino-cochleate (lower blot) while control cells receiving vehicle with cochleate alone (upper blot) showed no change in GAPDH protein levels.
FIGS. 4A-B are photographs of cells treated with morpholino-cochleates demonstrating delivery of the morpholinos into the cell cytosol and nucleus.
FIG. 5 is a graph summarizing in vivo antisense IL-10 experiments set forth Example 4.
FIG. 6 is a graph of absorption due to color development in the ELISA assay for surface erb B2 expression in SKOV cells for siRNA-cochleates, empty cochleates, and Lipofectamine formulated siRNA against erb B2 expression.
FIG. 7 is a series of fluorescent confocal microscopy images of the SKOV3 cells 24 hours post-exposure to: empty cochleates (panel A), 1% rhodamine-labelled cochleates (panel B), anti-erb B2 siRNA-cochleates (panel C), and Cy5 labelled anti-erb B2 siRNA-cochleates (panel D), indicating successful delivery of siRNA to the cells and partial knockdown of cytoplasmic erb B2 expression.
FIG. 8 is a series of confocal microscopy images of SKOV3 cells 24 hours post-exposure to: empty cochleates (panel A), 1% rhodamine-labelled cochleates (panel B), anti-erb B2 siRNA-cochleates (panel C), and Cy5 labelled anti-erb B2 siRNA-cochleates (panel D), indicating successful delivery of siRNA to the cells and partial knockdown of cell surface erb B2 expression.
FIG. 9 is a graph indicating the partial knockdown effect of anti-erb B2 siRNA-cochleates formulated with PEI, and washed to remove free siRNA, on SKOV3 cells.
FIG. 10 is a graph indicating indicated increased RNAi effect in encochleated siRNA versus unencochleated siRNA in SKOV3 cells.
DETAILED DESCRIPTION OF THE INVENTION
A novel approach to the delivery of siRNA and morpholino antisense molecules has now been discovered, thus providing improved modes of gene therapy. The present invention employs cochleate delivery vehicles to protect and deliver siRNA and morpholinos against target mRNA in cells, tissues, organs, and to organisms, e.g., animals and humans in a variety of dosage forms (e.g., oral capsules and liquids) in a safe and effective manner
DEFINITIONS
So that the invention may be more readily understood, certain terms are first defined.
The term “nucleoside” refers to a molecule having a purine or pyrimidine base covalently linked to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine and thymidine. The term “nucleotide” refers to a nucleoside having one or more phosphate groups joined in ester linkages to the sugar moiety. Exemplary nucleotides include nucleoside monophosphates, diphosphates and triphosphates. The terms “polynucleotide” and “nucleic acid molecule” are used interchangeably herein and refer to a polymer of nucleotides joined together by a phosphodiester linkage between 5′ and 3′ carbon atoms.
The term “nucleotide analog” or “altered nucleotide” or “modified nucleotide” refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides. Preferred nucleotide analogs are modified at any position so as to alter certain chemical properties of the nucleotide yet retain the ability of the nucleotide analog to perform its intended function. Examples of positions of the nucleotide which may be derivatized include the 5 position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, etc.; the 6 position, e.g., 6-(2amino)propyl uridine; the 8-position for adenosine and/or guanosines, e.g., 8-bromo guanosine, 8-chloro guanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include deaza nucleotides, e.g., 7-deaza-adenosine; and N-modified (e.g., alkylated, e.g., N6methyl adenosine, or as otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.
Nucleotide analogs may also comprise modifications to the sugar portion of the nucleotides. For example the 2′OH-group may be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, COOR, or OR, wherein R is substituted or unsubstituted C1-C6 alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications include those described in U.S. Pat. Nos. 5,858,988, and 6,291,438.
The phosphate group of the nucleotide may also be modified, e.g., by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioates), or by making other substitutions which allow the nucleotide to perform its intended function such as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11 (5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11.2):77-85, and U.S. Pat. No. 5,684,143. Certain of the above-referenced modifications (e.g., phosphate group modifications) preferably decrease the rate of hydrolysis of, for example, polynucleotides comprising said analogs in vivo or in vivo.
The term “RNA” or “RNA molecule” or “ribonucleic acid molecule” refers to a polymer of ribonucleotides. The term “DNA” or “DNA molecule” or deoxyribonucleic acid molecule” refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally (e.g., by DNA replication or transcription of DNA, respectively).
RNA can be post-transcriptionally modified. DNA and RNA can also be chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double stranded, i.e., dsRNA and dsDNA, respectively). “mRNA” or “messenger RNA” is single-stranded RNA that specifies the amino acid sequence of one or more polypeptide chains. This information is translated during protein synthesis when ribosomes bind to the mRNA.
As used herein, the term “small interfering RNA” (“siRNA”) (also referred to in the art as “short interfering RNAs”) refers to a double stranded RNA (or RNA analog) comprising between about 10-50 nucleotides (or nucleotide analogs) which is capable of directing or mediating RNA interference.
The term “oligonucleotide” refers to a short polymer of nucleotides and/or nucleotide analogs. The term “RNA analog” refers to an polynucleotide (e.g., a chemically synthesized polynucleotide) having at least one altered or modified nucleotide as compared to a corresponding unaltered or unmodified RNA, but retaining the same or similar nature or function as the corresponding unaltered or unmodified RNA. As discussed above, the oligonucleotides may be linked with linkages which result in a lower rate of hydrolysis of the RNA analog as compared to an RNA molecule with phosphodiester linkages. For example, the nucleotides of the analog may comprise methylenediol, ethylene diol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate, phophoroamidate, and/or phosphorothioate linkages. Preferred RNA analogues include sugar- and/or backbone-modified ribonucleotides and/or deoxyribonucleotides. Such alterations or modifications can further include addition of non-nucleotide material, such as to the end(s) of the RNA or internally (at one or more nucleotides of the RNA). An RNA analog need only be sufficiently similar to natural RNA that it has the ability to mediate (mediates) RNA interference.
As used herein, an “identical” oligonucleotide has the same sequence as the reference nucleotide subsequence to which the oligonucleotide is being compared. An “exactly complementary” oligonucleotide refers to an oligonucleotide whose complement has the same sequence as the reference nucleotide subsequence to which the oligonucleotide is being compared. A “substantially complementary” and a “substantially identical” oligonucleotide have the ability to specifically hybridize to a reference gene, DNA, cDNA, or mRNA, and its exact complement.
As used herein, the term “RNA interference” (“RNAi”) refers to a selective intracellular degradation of RNA to mediate, reduce or silence the expression of a target gene.
An siRNA “that mediates RNAi against a target mRNA” refers to an siRNA including a sequence sufficiently complementary to a target RNA (e.g. mRNA or RNA that can be spliced to produce one or more mRNAs) to trigger the destruction of the target mRNA by the RNAi machinery or process.
A morpholino “that mediates translation of a target mRNA” refers to a morpholino including a sequence sufficiently complementary to a target RNA (e.g. mRNA or RNA that can be spliced to produce one or more mRNAs) to interfere with translation of the mRNA into a protein.
As used herein, the term “isolated RNA” or “isolated siRNA” refers to RNA or siRNA molecules, respectively, which are substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
As used herein, the terms “cochleate,” “lipid precipitate” and “precipitate” are used interchangeably to refer to a lipid precipitate component that generally includes alternating cationic and lipid bilayer sheets with little or no internal aqueous space, typically stacked and/or rolled up, wherein the cationic sheet is comprised of one or more multivalent cations. Additionally, the term “encochleated” means associated with the cochleate structure, e.g. by incorporation into the cationic sheet, and/or inclusion in the lipid bilayer.
As used herein, the term “multivalent cation” refers to a divalent cation or higher valency cation, or any compound that has at least two positive charges, including mineral cations such as calcium, barium, zinc, iron and magnesium and other elements, such as drugs and other compounds, capable of forming ions or other structures having multiple positive charges capable of chelating and bridging negatively charged lipids. Additionally or alternatively, the multivalent cation can include other multivalent cationic compounds, e.g., cationic or protonized cargo moieties.
The lipid employed in the present invention preferably includes one or more negatively charged lipids. As used herein, the term “negatively charged lipid” includes lipids having a head group bearing a formal negative charge in aqueous solution at an acidic, basic or physiological pH, and also includes lipids having a zwitterionic head group.
The term “in vitro” has its art recognized meaning, e.g., involving purified reagents or extracts, e.g., cell extracts. The term “in vivo” also has its art recognized meaning, e.g., involving living cells, e.g., immortalized cells, primary cells, cell lines, and/or cells in an organism.
A gene or mRNA “involved” in or “associated with” a disorder includes a gene or mRNA, the normal or aberrant expression or function of which effects or causes a disease or disorder or at least one symptom of said disease or disorder.
The phrase “examining the function of a target mRNA” refers to examining or studying the expression, activity, function or phenotype arising therefrom, in the host cell, tissue or organism.
Various methodologies of the instant invention include a step that involves comparing a value, level, feature, characteristic, property, etc. to a “suitable control,” referred to interchangeably herein as an “appropriate control.” A “suitable control” or “appropriate control” is any control or standard familiar to one of ordinary skill in the art useful for comparison purposes. In one embodiment, a “suitable control” or “appropriate control” is a value, level, feature, characteristic, property, etc. determined prior to performing an RNAi methodology, as described herein. For example, a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, etc. can be determined prior to introducing an siRNA of the invention into a cell or organism. In another embodiment, a “suitable control” or “appropriate control” is a value, level, feature, characteristic, property, etc. determined in a cell or organism, e.g. a control or normal cell or organism, exhibiting, for example, normal traits. In yet another embodiment, a “suitable control” or “appropriate control” is a predefined value, level, feature, characteristic, property, etc.
The cochleates of the present invention can also include one or more aggregation inhibitors. The term “aggregation inhibitor,” as used herein, refers to an agent that inhibits aggregation of cochleates. The aggregation inhibitor typically is present at least on the surface of the cochleate, and may only be present on the surface of the cochleate (e.g., when the aggregation inhibitor is introduced after cochleate formation). Aggregation inhibitors can be added before, after, and/or during cochleate formation.
The terms “coat,” “coated,” “coating,” and the like, unless otherwise indicated, refer to an agent (e.g. an aggregation inhibitor) present at least on the outer surfaces of a cochleate. Such agents may be associated with the bilayer by incorporation of at least part of the agent into the bilayer, and/or may be otherwise associated, e.g., by ionic attraction to the cation or hydrophobic or ionic attraction to the lipid.
“Treatment”, or “treating” as used herein, refers to the application or administration of a therapeutic agent (e.g., an siRNA cochleate) to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has a disease or disorder, a symptom of disease or disorder or a predisposition toward a disease or disorder, that effects or otherwise contributes to curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving or affecting the disease or disorder, the symptoms of the disease or disorder, or the predisposition toward disease.
The term “biologically effective amount” is that amount necessary or sufficient to produce a desired biological response.
An “antisense” oligonucleotide is an oligonucleotide that is substantially complementary to a target nucleotide sequence and has the ability to specifically hybridize to the target nucleotide sequence.
“Morpholino oligonucleotides” and “morpholinos” are used interchangeably, and refer to oligonucleotides having a morpholino backbone.
Various aspects of the invention are described in further detail in the following subsections.
siRNA-Cochleate Compositions
In one aspect, the present invention features encochleated siRNA compositions. The siRNA-cochleate compositions generally include a cochleate, and an siRNA associated with the cochleate.
Preferably, the siRNA molecule has a length from about 10-50 or more nucleotides. More preferably, the siRNA molecule has a length from about 15-45 nucleotides. Even more preferably, the siRNA molecule has a length from about 19-40 nucleotides. Even more preferably, the siRNA molecule has a length of from about 21-23 nucleotides.
The siRNA of the invention preferably mediates RNAi against a target mRNA. The siRNA molecule can be designed such that every residue is complementary to a residue in the target molecule. Alternatively, one or more substitutions can be made within the molecule to increase stability and/or enhance processing activity of said molecule. Substitutions can be made within the strand or can be made to residues at the ends of the strand.
The target mRNA cleavage reaction guided by siRNAs is sequence specific. In general, siRNA containing a nucleotide sequence identical to a portion of the target gene are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Sequence variations can be tolerated including those that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition.
Moreover, not all positions of an siRNA contribute equally to target recognition. Mismatches in the center of the siRNA are most critical and essentially abolish target RNA cleavage. In contrast, the 3′ nucleotides of the siRNA do not contribute significantly to specificity of the target recognition. Generally, residues at the 3′ end of the siRNA sequence which is complementary to the target RNA (e.g., the guide sequence) are not critical for target RNA cleavage.
Sequence identity may readily be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or of two amino acid sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology=# of identical positions/total # of positions×100), optionally penalizing the score for the number of gaps introduced and/or length of gaps introduced.
The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the alignment generated over a certain portion of the sequence aligned having sufficient identity but not over portions having low degree of identity (i.e., a local alignment). A preferred, non-limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. NatL Acad Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. NatL Acad. Sci. USA 90:5873. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (I 990) J Mol Biol. 215:403-10.
In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the entire length of the sequences aligned (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for the global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
Greater than 90% sequence identity, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% sequence identity, between the siRNA and the portion of the target mRNA is preferred. Alternatively, the siRNA may be defined functionally as a nucleotide sequence (or oligonucleotide sequence) that is capable of hybridizing with a portion of the target mRNA transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing). Additional hybridization conditions include hybridization at 70° C. in 1×SSC or 50° C. in 1×SSC, 50% formamide followed by washing at 70° C. in 0.3×SSC or hybridization at 70° C. in 4×SSC or 50° C. in 4×SSC, 50% formarmide followed by washing at 67° C. in 1×SSC. The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10° C. less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, Tm(° C.)=2(# of A+T bases)+4(# of G+C bases). For hybrids between 18 and 49 base pairs in length, Tm(° C.)=81.5+16.6(log10 [Na+])+0.41 (% G+C)−(600/N), where N is the number of bases in the hybrid, and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] for 1×SSC=0.165 M). Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold 15 Spring Harbor, N.Y., chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference. The length of the identical nucleotide sequences may be at least about or about equal to 10, 12, 15, 17, 20, 22, 25, 27, 30, 32, 35, 37, 40, 42, 45, 47 or 50 bases.
In one embodiment, the siRNA molecules of the present invention are modified to improve stability in serum or in growth medium for cell cultures. In order to enhance the stability, the 3′-residues may be stabilized against degradation, e.g., they may be selected such that they consist of purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine by 2′-deoxythymidine is tolerated and does not affect the efficiency of RNA interference. For example, the absence of a 2′hydroxyl may significantly enhance the nuclease resistance of the siRNAs in tissue culture medium.
In another embodiment of the present invention the siRNA molecule may contain at least one modified nucleotide analogue. The nucleotide analogues may be located at positions where the target-specific activity, e.g., the RNAi mediating activity is not substantially effected, e.g., in a region at the 5′-end and/or the 3′-end of the RNA molecule. Particularly, the ends may be stabilized by incorporating modified nucleotide analogues.
Nucleotide analogues include sugar- and/or backbone-modified ribonucleotides (i.e., include modifications to the phosphate-sugar backbone). For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. In preferred backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g., of phosphothioate group. In preferred sugar modified ribonucleotides, the 2′OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or NO2, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
Nucleotide analogues also include nucleobase-modified ribonucleotides, i.e., ribonucleotides, containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include, but are not limited to, uridine and/or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and/or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine are suitable. It should be noted that the above modifications may be combined.
RNA may be produced enzymatically or by partial/total organic synthesis, any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis. In one embodiment, an siRNA is prepared chemically. Methods of synthesizing RNA molecules are known in the art, in particular, the chemical synthesis methods as described in Verina and Eckstein (1998), Annul Rev. Biochem. 67:99. In another embodiment, an siRNA is prepared enzymatically. For example, an siRNA can be prepared by enzymatic processing of a long, double-stranded RNA having sufficient complementarity to the desired target mRNA. Processing of long RNA can be accomplished in vitro, for example, using appropriate cellular lysates and siRNAs can be subsequently purified by gel electrophoresis or gel filtration. siRNA can then be denatured according to art-recognized methodologies. In an exemplary embodiment, siRNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the siRNA may be used with no or a minimum of purification to avoid losses due to sample processing. p Alternatively, the siRNAs can also be prepared by enzymatic transcription from synthetic DNA templates or from DNA plasmids isolated from recombinant bacteria. Typically, phage RNA polymerases are used such as T7, T3 or SP6 RNA polyimerase (Milligan and Uhlenbeck (1989) Methods EnzynioL 180:51-62). The RNA may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to inhibit annealing, and/or promote stabilization of the double strands.
Commercially available design tools and kits, such as those available from Ambion, Inc. (Austin, Tex.), and the Whitehead Institute of Biomedical Research at MIT (Cambridge, Mass.) allow for the design and production of siRNA. By way of example, a desired mRNA sequence can be entered into a sequence program that will generate sense and antisense target strand sequences. These sequences can then be entered into a program that determines the sense and antisense siRNA oligonucleotide templates. The programs can also be used to add, e.g., hairpin inserts or T1 promoter primer sequences. Kits also can then be employed to build siRNA expression cassettes.
In various embodiments, siRNAs are synthesized in vivo, in situ, and in vitro. Endogenous RNA polymerase of the cell may mediate transcription in vivo or in situ, or cloned RNA polymerase can be used for transcription in vivo or in vitro. For transcription from a transgene in vivo or an expression construct, a regulatory region (e.g., promoter, enhancer, silencer, splice donor and acceptor, polyadenylation) may be used to transcribe the siRNAs Inhibition may be targeted by specific transcription in an organ, tissue, or cell type; stimulation of an environmental condition (e.g., infection, stress, temperature, chemical inducers); and/or engineering transcription at a developmental stage or age. A transgenic organism that expresses siRNAs from a recombinant construct may be produced by introducing the construct into a zygote, an embryonic stem cell, or another multipotent cell derived from the appropriate organism.
In one embodiment, the target mRNA of the invention specifies the amino acid sequence of at least one protein such as a cellular protein (e.g., a nuclear, cytoplasmic, transmembrane, or membrane-associated protein). In another embodiment, the target mRNA of the invention specifies the amino acid sequence of an extracellular protein (e.g., an extracellular matrix protein or secreted protein). As used herein, the phrase “specifies the amino acid sequence” of a protein means that the mRNA sequence is translated into the amino acid sequence according to the rules of the genetic code. The following classes of proteins are listed for illustrative purposes: developmental proteins (e.g., adhesion molecules, cyclin kinase inhibitors, Wnt family members, Pax family members, Winged helix family members, Hox family members, cytokines/lymphokines and their receptors, growth/differentiation factors and their receptors, neurotransmitters and their receptors); oncogene-encoded proteins (e.g., ABLI, BCLI, BCL2, BCL6, CBFA2. CBL, CSFIR, ERBA, ERBB, EBRB2, ERBB2, ERBB3, ETSI, ETSI, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM 1, PML, RET, SRC, TALI, TCL3, and YES); tumor suppressor proteins (e.g., APC, BRCA1, BRCA2, MADH4, MCC, NF 1, NF2, RB 1, TP53, and WTI); and enzymes (e.g., ACC synthases and oxidases, ACP desaturases and hydroxylases, ADPglucose pyrophorylases, acetylases and deacetylases, ATPases, alcohol dehydrogenases, amylases, amyloglucosidases, catalases, cellulases, chalcone synthases, chitinases, cyclooxygenases, decarboxylases, dextrinases, DNA and RNA polymerases, galactosidases, glucanases, glucose oxidases, granule-bound starch synthases, GTPases, helicases, hemicellulases, integrases, inulinases, invertases, isomerases, kinases, lactases, lipases, lipoxygenases, lysozymes, nopaline synthases, octopine synthases, pectinesterases, peroxidases, phosphatases, phospholipases, phosphorylases, phytases, plant growth regulator synthases, polygalacturonases, proteinases and peptidases, pullanases, recombinases, reverse transcriptases, RUBISCOs, topoisomerases, and xylanases), proteins involved in tumor growth (including vascularization) or in metastatic activity or potential, including cell surface receptors and ligands as well as secreted proteins, cell cycle regulatory, gene regulatory, and apoptosis regulatory proteins, immune response, inflammation, complement, or clotting regulatory proteins.
As used herein, the term “oncogene” refers to a gene which stimulates cell growth and, when its level of expression in the cell is reduced, the rate of cell growth is reduced or the cell becomes quiescent. In the context of the present invention, oncogenes include intracellular proteins, as well as extracellular growth factors which may stimulate cell proliferation through autocrine or paracrine function. Examples of human oncogenes against which siRNA and morpholino constructs can designed include c-myc, c-myb, mdm2, PKA-I (protein kinase A type I), Abl-1, Bcl2, Ras, c-Raf kinase, CDC25 phosphatases, cyclins, cyclin dependent kinases (cdks), telomerase, PDGF/sis, erb-B, fos, jun, mos, and src, to name but a few. In the context of the present invention, oncogenes also include a fusion gene resulted from chromosomal translocation, for example, the Bcr/Abl fusion oncogene.
Further proteins include cyclin dependent kinases, c-myb, c-myc, proliferating cell nuclear antigen (PCNA), transforming growth factor-beta (TGF-beta), and transcription factors nuclear factor kappaB (NF-.kappa.B), E2F, HER-2/neu, PKA, TGF-alpha, EGFR, TGF-beta, IGFIR, P12, MDM2, BRCA, Bcl-2, VEGF, MDR, ferritin, transferrin receptor, IRE, C-fos, HSP27, C-raf and metallothionein genes.
The siRNA employed in the present invention can be directed against the synthesis of one or more proteins. Additionally or alternatively, there can be more than one siRNA directed against a protein, e.g., duplicate siRNA or siRNA that correspond to overlapping or non-overlapping target sequences against the same target protein. Accordingly, in one embodiment two, three, four or any plurality of siRNAs against the same target mRNA can be including in the cochleate compositions of the invention. Additionally, several siRNAs directed against several proteins can be employed. Alternatively, the siRNA can be directed against structural or regulatory RNA molecules that do not code for proteins.
In a preferred aspect of the invention, the target mRNA molecule of the invention specifies the amino acid sequence of a protein associated with a pathological condition. For example, the protein may be a pathogen-associated protein (e.g., a viral protein involved in immunosuppression or immunoavoidance of the host, replication of the pathogen, transmission of the pathogen, or maintenance of the infection), or a host protein which facilitates entry of the pathogen into the host, drug metabolism by the pathogen or host, replication or integration of the pathogen's genome, establishment or spread of infection in the host, or assembly of the next generation of pathogen. Alternatively, the protein may be a tumor-associated protein or an autoimmune disease-associated protein.
In one embodiment, the target mRNA molecule of the invention specifies the amino acid sequence of an endogenous protein (i.e. a protein present in the genome of a cell or organism). In another embodiment, the target mRNA molecule of the invention specifies the amino acid sequence of a heterologous protein expressed in a recombinant cell or a genetically altered organism. In another embodiment, the target mRNA molecule of the invention specifies the amino acid sequence of a protein encoded by a transgene (i.e., a gene construct inserted at an ectopic site in the genome of the cell). In yet another embodiment, the target mRNA molecule of the invention specifies the amino acid sequence of a protein encoded by a pathogen genome which is capable of infecting a cell or an organism from which the cell is derived.
By inhibiting the expression of such proteins, valuable information regarding the function of said proteins and therapeutic benefits which may be obtained from said inhibition may be obtained.
Accordingly, in one embodiment, the siRNA-cochleate compositions of the present invention can be utilized in studies of mammalian cells to clarify the role of specific structural and catalytic proteins. In another embodiment, they can be used in a therapeutic application to specifically target pathogenic organisms, including fungi, bacteria, and viruses.
Cochleate delivery vehicles are stable lipid-cation precipitates that can be composed of simple, naturally occurring materials, e.g., phosphatidylserine, and calcium. Mixtures of naturally occurring molecules (e.g., soy lipids) and/or synthetic or modified lipids can be utilized.
The cochleate structure provides protection from degradation for associated “encochleated” moieties. Divalent cation concentrations in vivo in serum and mucosal secretions are such that the cochleate structure is maintained. Hence, the majority of cochleate-associated molecules, e.g., cargo moieties, are present in the inner layers of a primarily solid, non-aqueous, stable, impermeable structure. Since the cochleate structure includes a series of solid layers, components within the interior of the cochleate structure remain substantially intact, even though the outer layers of the cochleate may be exposed to harsh environmental conditions or enzymes.
The cochleate interior is primarily free of water and resistant to penetration by oxygen. Oxygen and water are primarily responsible for the decomposition and degradation of molecules which can lead to reduced shelf-life. Accordingly, encochleation should also impart extensive shelf-life stability to encochleated siRNAs.
With respect to storage, cochleates can be stored in cation-containing buffer, or lyophilized or otherwise converted to a powder, and stored at room temperature. If desired, the cochleates also can be reconstituted with liquid prior to administration. Cochleate preparations have been shown to be stable for more than two years at 4° C. in a cation-containing buffer, and at least one year as a lyophilized powder at room temperature.
In one embodiment, the cochleate comprises a negatively charged lipid component and a multivalent cation component.
In one embodiment, the lipid is a mixture of lipids, comprising at least 75% negatively charged lipid. In another embodiment, the lipid includes at least 85% negatively charged lipid. In other embodiments, the lipid includes at least 90%, 95% or even 99% negatively charged lipid. All ranges and values between 60% and 100% negatively charged lipid are meant to be encompassed herein.
The negatively charged lipid can include soy-based lipids. Preferably, the lipid includes phospholipids, such as soy phospholipids (soy-based phospholipids). The negatively charged lipid can include phosphotidyl serine (PS), dioleoylphosphatidylserine (DOPS), phosphatidic acid (PA), phosphatidylinositol (PI), and/or phosphatidyl glycerol (PG) and or a mixture of one or more of these lipids with other lipids. Additionally or alternatively, the lipid can include phosphatidylcholine (PC), phosphatidylethanolamine (PE), diphosphotidylglycerol (DPG), dioleoyl phosphatidic acid (DOPA), distearoyl phosphatidylserine (DSPS), dimyristoyl phosphatidylserine (DMPS), dipalmitoyl phosphatidylgycerol (DPPG) and the like.
The lipids can be natural or synthetic. For example, the lipid can include esterified fatty acid acyl chains, or organic chains attached by non-ester linkages such as ether linkages (as described in U.S. Pat. No. 5,956,159), disulfide linkages, and their analogs.
In one embodiment the lipid chains are from about 6 to about 26 carbon atoms, and the lipid chains can be saturated or unsaturated. Fatty acyl lipid chains useful in the present invention include, but are not limited to, n-tetradecanoic, n-hexadecanoic acid, n-octadecanoic acid, n-eicosanoic acid, n-docosanoic acid, n-tetracosanoic acid, n-hexacosanoic acid, cis-9-hexadecenoic acid, cis-9-octadecenoic acid, cis,cis-9,12-octadecedienoic acid, all-cis-9,12,15-octadecetrienoic acid, all-cis-5,8,11,14-eicosatetraenoic acid, all-cis-4,7,10,13,16,19-docosahexaenoic acid, 2,4,6,8-tetramethyl decanoic acid, and lactobacillic acid, and the like.
In some embodiments, pegylated lipid also is included. Pegylated lipid includes lipids covalently linked to polymers of polyethylene glycol (PEG). PEG's are conventionally classified by their molecular weight, thus PEG 6,000 MW, e.g., has a molecular weight of about 6000. Adding pegylated lipid generally will result in an increase of the amount of compound (e.g., peptide, nucleotide, and nutrient) that can be incorporated into the precipitate. An exemplary pegylated lipid is dipalmitoylphosphatidylehtanolamine (DPPE) bearing PEG 5,000 MW.
The siRNA-cochleate compositions of the present invention can be provided in a variety of forms (e.g. powder, liquid, suspension) with or without additional components. Suitable forms and additives, excipients, carriers and the like are described herein.
Morpholino-Cochleate Compositions
The present invention also features encochleated morpholino antisense oligonucleotides (morpholinos) and methods (e.g., research and/or therapeutic methods) for using said morpholino-cochleates. In one aspect, the present invention provides a morpholino-cochleate composition that generally includes a cochleate, and a morpholino associated with the cochleate.
Morpholinos function by an RNase H-independent mechanism and are soluble in aqueous solutions, with most being freely soluble at mM concentrations (typically 10 mg/ml to over 100 mg/ml). Morpholinos have high affinity for RNA and efficiently invade even quite stable secondary structures in mRNAs, which results in effective and predictable targeting essentially anywhere from the 5′cap to about +25 of the protein coding region of mRNAs. Morpholinos are free of significant non-antisense effects while the alternative phosphorothioates are plagued by a host of well-documented non-antisense effects. Morpholinos include a morpholine backbone, which is not recognized by nucleases and therefore is stable in the cell compared to phosphorothioates, which typically are degraded in biological systems in a matter of hours. Consequently, considerably fewer morpholinos are required (approximately 100× less) to achieve similar antisense effects. Morpholinos also are superior to phosphorothioates because targeting is more predictable, the activity in cells is more reliable, and the sequence specificity is superior. Summerton, Biochimica et Biophysica Acta 1489: 141-158 (1999). Morpholinos can be designed and prepared according to known methods. E.g., Summerton and Weller, Antisense and Nucleic Acid Drug Development 7187-195 (1997).
Morpholino oligonucleotides suitable for use in the present invention include antisense morpholino oligonucleotides. The morpholino can be between about 7 and 100 nucleotides long, between 10 and 50, between 20 and 35, and between 15 and 30 nucleotides long. In a preferred embodiment, the morpholino oligonucleotide is between about 18 and about 25 nucleotides long. The oligonucleotides can be 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides long.
The morpholinos of the invention preferably mediate RNA interference against a target gene. That is, preferably, the morpholino has a sequence sufficiently complementary to a target RNA (e.g. mRNA or RNA that can be spliced to produce one or more mRNAs) associated with a target gene to trigger the destruction of the target mRNA by the RNAi machinery or process. The morpholino molecule can be designed such that every residue is complementary to a residue in the target molecule. Alternatively, one or more substitutions can be made within the molecule to increase stability and/or enhance processing activity of said molecule. Substitutions can be made within the strand or can be made to residues at the ends of the strand.
The target mRNA cleavage reaction guided by morpholinos is sequence specific. In general, morpholinos containing a nucleotide sequence identical to a portion of the target gene are preferred for inhibition. However, 100% sequence identity between the morpholino and the target gene is not required to practice the present invention. Sequence variations can be tolerated including those that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, morpholino sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, morpholino sequences with nucleotide analog substitutions or insertions can be effective for inhibition.
Sequence identity may readily be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or of two amino acid sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology=# of identical positions/total # of positions×100), optionally penalizing the score for the number of gaps introduced and/or length of gaps introduced.
The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the alignment generated over a certain portion of the sequence aligned having sufficient identity but not over portions having low degree of identity (i.e., a local alignment). A preferred, non-limiting example of a local alignment algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. NatL Acad Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. NatL Acad. Sci. USA 90:5873. Such an algorithm is incorporated into the BLAST programs (version 2.0) of Altschul, et al. (I 990) J Mol Biol. 215:403-10.
In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389. In another embodiment, the alignment is optimized by introducing appropriate gaps and percent identity is determined over the entire length of the sequences aligned (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for the global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
Greater than 90% sequence identity, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% sequence identity, between the morpholino and the portion of the target RNA is preferred. Alternatively, the morpholino may be defined functionally as a nucleotide sequence (or oligonucleotide sequence) that is capable of hybridizing with a portion of the target mRNA transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing). Additional hybridization conditions include hybridization at 70° C. in 1×SSC or 50° C. in 1×SSC, 50% formamide followed by washing at 70° C. in 0.3×SSC or hybridization at 70° C. in 4×SSC or 50° C. in 4×SSC, 50% formarmide followed by washing at 67° C. in 1×SSC. The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10° C. less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, Tm(° C.)=2(# of A+T bases)+4(# of G+C bases). For hybrids between 18 and 49 base pairs in length, Tm(° C.)=81.5+16.6(log10 [Na+])+0.41 (% G+C)−(600/N), where N is the number of bases in the hybrid, and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] for 1×SSC=0.165 M). Additional examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold 15 Spring Harbor, N.Y., chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference. The length of the identical nucleotide sequences may be at least about or about equal to 10, 12, 15, 17, 20, 22, 25, 27, 30, 32, 35, 37, 40, 42, 45, 47 or 50 bases.
In one embodiment, the morpholino molecules of the present invention are modified to improve stability in serum or in growth medium for cell cultures. In order to enhance the stability, the 3′-residues may be stabilized against degradation, e.g., they may be selected such that they consist of purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine by 2′-deoxythymidine is tolerated and does not affect the efficiency of RNA interference. For example, the absence of a 2′hydroxyl may significantly enhance the nuclease resistance of the morpholinos in tissue culture medium.
In another embodiment of the present invention the morpholino molecule may contain at least one modified nucleotide analogue. The nucleotide analogues may be located at positions where the target-specific activity, e.g., the RNAi mediating activity is not substantially effected, e.g., in a region at the 5′-end and/or the 3′-end of the RNA molecule. Particularly, the ends may be stabilized by incorporating modified nucleotide analogues.
Nucleotide analogues include sugar- and/or backbone-modified ribonucleotides (i.e., include modifications to the phosphate-sugar backbone). For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. In preferred backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g., of phosphothioate group. In preferred sugar modified ribonucleotides, the 2′OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or NO2, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
Nucleotide analogues also include nucleobase-modified ribonucleotides, i.e., ribonucleotides, containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include, but are not limited to, uridine and/or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and/or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine are suitable. It should be noted that the above modifications may be combined.
RNA may be produced enzymatically or by partial/total organic synthesis, any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis. In one embodiment, a morpholino is prepared chemically. Methods of synthesizing RNA molecules are known in the art, in particular, the chemical synthesis methods as described in Verina and Eckstein (1998), Annul Rev. Biochem. 67:99. In another embodiment, a morpholino is prepared enzymatically. For example, a morpholino can be prepared by enzymatic processing of a long, double-stranded RNA having sufficient complementarity to the desired target mRNA. Processing of long RNA can be accomplished in vitro, for example, using appropriate cellular lysates and morpholinos can be subsequently purified by gel electrophoresis or gel filtration. Morpholinos can then be denatured according to art-recognized methodologies. In an exemplary embodiment, morpholinos can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the morpholino may be used with no or a minimum of purification to avoid losses due to sample processing.
In one embodiment, morpholinos are synthesized either in vivo, in situ, or in vitro. Endogenous RNA polymerase of the cell may mediate transcription in vivo or in situ, or cloned RNA polymerase can be used for transcription in vivo or in vivo. For transcription from a transgene in vivo or an expression construct, a regulatory region (e.g., promoter, enhancer, silencer, splice donor and acceptor, polyadenylation) may be used to transcribe the morpholinos Inhibition may be targeted by specific transcription in an organ, tissue, or cell type; stimulation of an environmental condition (e.g., infection, stress, temperature, chemical inducers); and/or engineering transcription at a developmental stage or age. A transgenic organism that expresses morpholinos from a recombinant construct may be produced by introducing the construct into a zygote, an embryonic stem cell, or another multipotent cell derived from the appropriate organism.
In one embodiment, the target mRNA of the invention specifies the amino acid sequence of at least one protein such as a cellular protein (e.g., a nuclear, cytoplasmic, transmembrane, or membrane-associated protein). In another embodiment, the target mRNA of the invention specifies the amino acid sequence of an extracellular protein (e.g., an extracellular matrix protein or secreted protein). As used herein, the phrase “specifies the amino acid sequence” of a protein means that the mRNA sequence is translated into the amino acid sequence according to the rules of the genetic code. The following classes of proteins are listed for illustrative purposes: developmental proteins (e.g., adhesion molecules, cyclin kinase inhibitors, Wnt family members, Pax family members, Winged helix family members, Hox family members, cytokines/lymphokines and their receptors, growth/differentiation factors and their receptors, neurotransmitters and their receptors); oncogene-encoded proteins (e.g., ABLI, BCLI, BCL2, BCL6, CBFA2. CBL, CSFIR, ERBA, ERBB, EBRB2, ETSI, ETSI, ETV6. FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM 1, PML, RET, SRC, TALI, TCL3, and YES); tumor suppressor proteins (e.g., APC, BRCA1, BRCA2, MADH4, MCC, NF 1, NF2, RB 1, TP53, and WTI); and enzymes (e.g., ACC synthases and oxidases, ACP desaturases and hydroxylases, ADPglucose pyrophorylases, acetylases and deacetylases, ATPases, alcohol dehydrogenases, amylases, amyloglucosidases, catalases, cellulases, chalcone synthases, chitinases, cyclooxygenases, decarboxylases, dextrinases, DNA and RNA polymerases, galactosidases, glucanases, glucose oxidases, granule-bound starch synthases, GTPases, helicases, hemicellulases, integrases, inulinases, invertases, isomerases, kinases, lactases, lipases, lipoxygenases, lysozymes, nopaline synthases, octopine synthases, pectinesterases, peroxidases, phosphatases, phospholipases, phosphorylases, phytases, plant growth regulator synthases, polygalacturonases, proteinases and peptidases, pullanases, recombinases, reverse transcriptases, RUBISCOs, topoisomerases, and xylanases), proteins involved in tumor growth (including vascularization) or in metastatic activity or potential, including cell surface receptors and ligands as well as secreted proteins, cell cycle regulatory, gene regulatory, and apoptosis regulatory proteins, immune response, inflammation, complement, or clotting regulatory proteins.
As used herein, the term “oncogene” refers to a gene which stimulates cell growth and, when its level of expression in the cell is reduced, the rate of cell growth is reduced or the cell becomes quiescent. In the context of the present invention, oncogenes include intracellular proteins, as well as extracellular growth factors which may stimulate cell proliferation through autocrine or paracrine function. Examples of human oncogenes against which siRNA and morpholino constructs can designed include c-myc, c-myb, mdm2, PKA-I (protein kinase A type I), Abl-1, Bcl2, Ras, c-Raf kinase, CDC25 phosphatases, cyclins, cyclin dependent kinases (cdks), telomerase, PDGF/sis, erb-B, fos, jun, mos, and src, to name but a few. In the context of the present invention, oncogenes also include a fusion gene resulted from chromosomal translocation, for example, the Bcr/Abl fusion oncogene.
Further proteins include cyclin dependent kinases, c-myb, c-myc, proliferating cell nuclear antigen (PCNA), transforming growth factor-beta (TGF-beta), and transcription factors nuclear factor kappaB (NF-.kappa.B), E2F, HER-2/neu, PKA, TGF-alpha, EGFR, TGF-beta, IGFIR, P12, MDM2, BRCA, Bcl-2, VEGF, MDR, ferritin, transferrin receptor, IRE, C-fos, HSP27, C-raf and metallothionein genes.
The morpholinos employed in the present invention can be directed against the synthesis of one or more proteins. Additionally or alternatively, there can be more than one morpholino directed against a protein, e.g., duplicate morholinos or morpholinos that correspond to overlapping or non-overlapping target sequences against the same target protein. Additionally, several morpholinos directed against several proteins can be employed. Accordingly, in one embodiment two, three, four or any plurality of morpholinos against the same target mRNA can be including in the cochleate compositions of the invention. Alternatively, the morpholino can be directed against structural or regulatory RNA molecules that do not code for proteins.
In a preferred aspect of the invention, the target mRNA molecule of the invention specifies the amino acid sequence of a protein associated with a pathological condition. For example, the protein may be a pathogen-associated protein (e.g., a viral protein involved in immunosuppression or immunoavoidance of the host, replication of the pathogen, transmission of the pathogen, or maintenance of the infection), or a host protein which facilitates entry of the pathogen into the host, drug metabolism by the pathogen or host, replication or integration of the pathogen's genome, establishment or spread of infection in the host, or assembly of the next generation of pathogen. Alternatively, the protein may be a tumor-associated protein or an autoimmune disease-associated protein.
In one embodiment, the target mRNA molecule of the invention specifies the amino acid sequence of an endogenous protein (i.e. a protein present in the genome of a cell or organism). In another embodiment, the target mRNA molecule of the invention specifies the amino acid sequence of a heterologous protein expressed in a recombinant cell or a genetically altered organism. In another embodiment, the target mRNA molecule of the invention specifies the amino acid sequence of a protein encoded by a transgene (i.e., a gene construct inserted at an ectopic site in the genome of the cell). In yet another embodiment, the target mRNA molecule of the invention specifies the amino acid sequence of a protein encoded by a pathogen genome which is capable of infecting a cell or an organism from which the cell is derived.
By inhibiting the expression of such proteins, valuable information regarding the function of said proteins and therapeutic benefits which may be obtained from said inhibition may be obtained.
Accordingly, in one embodiment, the morpholino-cochleate compositions of the present invention can be utilized in studies of mammalian cells to clarify the role of specific structural and catalytic proteins. In another embodiment, they can be used in a therapeutic application to specifically target pathogenic organisms, including fungi, bacteria, and viruses.
Cochleate delivery vehicles are stable lipid-cation precipitates that can be composed of simple, naturally occurring materials, e.g., phosphatidylserine, and calcium. Mixtures of naturally occurring molecules (e.g., soy lipids) and/or synthetic or modified lipids can be utilized.
The cochleate structure provides protection from degradation for associated “encochleated” moieties. Divalent cation concentrations in vivo in serum and mucosal secretions are such that the cochleate structure is maintained. Hence, the majority of cochleate-associated molecules, e.g., cargo moieties, are present in the inner layers of a primarily solid, non-aqueous, stable, impermeable structure. Since the cochleate structure includes a series of solid layers, components within the interior of the cochleate structure remain substantially intact, even though the outer layers of the cochleate may be exposed to harsh environmental conditions or enzymes.
The cochleate interior is primarily free of water and resistant to penetration by oxygen. Oxygen and water are primarily responsible for the decomposition and degradation of molecules which can lead to reduced shelf-life. Accordingly, encochleation should also impart extensive shelf-life stability to encochleated morpholinos.
With respect to storage, cochleates can be stored in cation-containing buffer, or lyophilized or otherwise converted to a powder, and stored at room temperature. If desired, the cochleates also can be reconstituted with liquid prior to administration. Cochleate preparations have been shown to be stable for more than two years at 4° C. in a cation-containing buffer, and at least one year as a lyophilized powder at room temperature.
In one embodiment, the cochleate comprises a negatively charged lipid component and a multivalent cation component.
In one embodiment, the lipid is a mixture of lipids, comprising at least 75% negatively charged lipid. In another embodiment, the lipid includes at least 85% negatively charged lipid. In other embodiments, the lipid includes at least 90%, 95% or even 99% negatively charged lipid. All ranges and values between 60% and 100% negatively charged lipid are meant to be encompassed herein.
The negatively charged lipid can include soy-based lipids. Preferably, the lipid includes phospholipids, such as soy phospholipids (soy-based phospholipids). The negatively charged lipid can include phosphotidyl serine (PS), dioleoylphosphatidylserine (DOPS), phosphatidic acid (PA), phosphatidylinositol (PI), and/or phosphatidyl glycerol (PG) and or a mixture of one or more of these lipids with other lipids. Additionally or alternatively, the lipid can include phosphatidylcholine (PC), phosphatidylethanolamine (PE), diphosphotidylglycerol (DPG), dioleoyl phosphatidic acid (DOPA), distearoyl phosphatidylserine (DSPS), dimyristoyl phosphatidylserine (DMPS), dipalmitoyl phosphatidylgycerol (DPPG) and the like.
The lipids can be natural or synthetic. For example, the lipid can include esterified fatty acid acyl chains, or organic chains attached by non-ester linkages such as ether linkages (as described in U.S. Pat. No. 5,956,159), disulfide linkages, and their analogs.
In one embodiment the lipid chains are from about 6 to about 26 carbon atoms, and the lipid chains can be saturated or unsaturated. Fatty acyl lipid chains useful in the present invention include, but are not limited to, n-tetradecanoic, n-hexadecanoic acid, n-octadecanoic acid, n-eicosanoic acid, n-docosanoic acid, n-tetracosanoic acid, n-hexacosanoic acid, cis-9-hexadecenoic acid, cis-9-octadecenoic acid, cis,cis-9,12-octadecedienoic acid, all-cis-9,12,15-octadecetrienoic acid, all-cis-5,8,11,14-eicosatetraenoic acid, all-cis-4,7,10,13,16,19-docosahexaenoic acid, 2,4,6,8-tetramethyl decanoic acid, and lactobacillic acid, and the like.
In some embodiments, pegylated lipid also is included. Pegylated lipid includes lipids covalently linked to polymers of polyethylene glycol (PEG). PEG's are conventionally classified by their molecular weight, thus PEG 6,000 MW, e.g., has a molecular weight of about 6000. Adding pegylated lipid generally will result in an increase of the amount of compound (e.g., peptide, nucleotide, and nutrient) that can be incorporated into the precipitate. An exemplary pegylated lipid is dipalmitoylphosphatidylehtanolamine (DPPE) bearing PEG 5,000 MW.
The morpholino-cochleate compositions of the present invention can be provided in a variety of forms (e.g. powder, liquid, suspension) with or without additional components. Suitable forms and additives, excipients, carriers and the like are described herein.
Aggregation Inhibitors
The cochleates and cochleate compositions of the present invention can optionally include an aggregation inhibitor. Aggregation inhibitors work in part by modifying the surface characteristics of the cochleates such that aggregation is inhibited. Aggregation can be inhibited, for example, by steric bulk and/or a change in the nature of the cochleate structure, e.g., a change in the surface hydrophobicity and/or surface charge.
Aggregation can be inhibited and even reversed, and individual cochleate particles can be stabilized by changing the surface properties of the cochleates and thereby inhibiting cochleate-cochleate interaction. Aggregation can be inhibited by including in the liposome suspension a material that prevents liposome-liposome interaction at the time of calcium addition and thereafter. Alternatively, the aggregation inhibitor can be added after formation of cochleates. Additionally, the amount of aggregation inhibitor can be varied, thus allowing modulation of the size of the cochleates.
In one embodiment, the aggregation inhibitor can be employed to achieve cochleates that are significantly smaller and have narrower particle size distributions than compositions without aggregation inhibitors. Such compositions are advantageous for several reasons including that they can allow for greater uptake by cells, and rapid efficacy. Such a composition is suitable, e.g., when it is desired to rapidly and effectively deliver encochleated molecultes. Moreover, cochleate size can have a targeting affect in that some cells may take up particles of a certain size more or less effectively. Size may also affect the manner in which cochleates interact with a cell (e.g., fusion events or uptake).
In another embodiment, the aggregation inhibitor can be employed to achieve cochleate compositions having a particle size relatively larger than that which can be achieved with or without aggregation inhibitors. Such a composition can be useful, e.g., when delayed uptake and/or release of encochleated molecules is desired, or when targeted cells or organs more effectively take up cochleates in the relatively larger size range. Such compositions also may have sustained activity (relative to smaller cochleate compositions) because it can take longer for the molecule to be released from a larger cochleate, e.g., if multiple fusion events are required.
In yet another embodiment, the cochleate composition has a wide particle size distribution such that the encochleate molecule (e.g., siRNA or morpholino and any additional cargo moeity) is released over a period of time because smaller cochleates are rapidly taken up initially followed by take up or fusion events with increasingly larger cochleates. In addition, size may not only affect what type of cells take up the cochleates, but also how the cochleates interact with certain cells, e.g., size may effect whether a cochleate is taken up by a cell or undergoes one or more fusion events with a cell.
Moreover, in yet further embodiments, several compositions can be combined for desired release profiles, e.g., a pulsed released, or combined release. For example, a rapid release nanocochleate composition can be mixed with a delayed-release larger size or even standard cochleate composition, such that an immediate and a delayed release is realized. In addition, the cochleate compositions may have different siRNAs or morpholinos.
An aggregation inhibitor also can be employed to stabilize particle size and particle size distribution. For example, it can be used to “lock-in” the cochleate size and distribution of standard cochleates and/or cochleates having an aggregation inhibitor. While the cochleates of the invention typically are stable over long periods of time, standard cochleates (cochleates formed without aggregation inhibitors) can tend to aggregate over time. Thus, standard cochleates can be stabilized by addition to such aggregation inhibitors, e.g., addition of methylcellulose after cochleate formation.
Accordingly, in one embodiment, cochleate compositions of the invention have a mean diameter less than about 1 micrometer, e.g., less than about 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 100 nm, 50 nm, 10 nm, or 1 nm All individual values and ranges within these ranges are meant to be included and are within the scope of this invention. In another embodiment, cochleate compositions of the invention have a mean diameter about equal to or greater than about 1 micrometer, e.g., 2, 3, 4, 5, 10, 50, or 100 micrometers. All individual values and ranges within these ranges are meant to be included and are within the scope of this invention.
In one embodiment, the size distribution is narrow relative to that observed in standard cochleates (cochleates formed without aggregation inhibitors). Preferably, the cochleate compositions have a size distribution of less than about 1 μm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm. All individual values between these values (550 nm, 420 nm, 475 nm, etc.), are meant to be included and are within the scope of this invention. Such cochleate compositions are particularly desirable where uptake by macrophages is desired. It can readily be appreciated that particle size can be adjusted to a size suitable for uptake by desired organs or cells and/or unsuitable for uptake by organs or cells. In another embodiment, a wider size distribution of cochleates is employed, e.g., about 10, 20, 50, 100, 200, 300, 400 or 500 micrometers. All individual values within these ranges are meant to be included and are within the scope of this invention. Such cochleate compositions can be useful for long term release of cargo moieties.
Additionally, as discussed above, the invention contemplates combination of cochleate populations to achieve a desired release pattern, e.g., pulsed release and/or timed release of siRNAs or morpholinos against one or more target mRNAs.
The type and/or amount of aggregation inhibitor used can also determine the size of resulting cochleate. The presence of an aggregation inhibitor in differing concentrations also allows regulation of cochleate size distribution.
Suitable aggregation inhibitors that can be employed in accordance with the present invention, include but are not limited to at least one of the following: casein, K-casein, milk, albumin, serum albumin, bovine serum albumin, methylcellulose, ethylcellulose, propylcellulose, hydroxycellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, polyvinyl pyrrolidone, carboxymethyl cellulose, carboxyethyl cellulose, pullulan, polyvinyl alcohol, sodium alginate, polyethylene glycol, polyethylene oxide, xanthan gum, tragacanth gum, guar gum, acacia gum, arabic gum, polyacrylic acid, methylmethacrylate copolymer, carboxyvinyl polymer, amylose, high amylose starch, hydroxypropylated high amylose starch, dextrin, pectin, chitin, chitosan, levan, elsinan, collagen, gelatin, zein, gluten, carrageenan, carnauba wax, shellac, latex polymers, milk protein isolate, soy protein isolate, whey protein isolate and mixtures thereof.
A preferred aggregation inhibitor is casein. Casein is a highly phosphorylated, calcium binding protein. Without wishing to be bound to any particular theory, it is believed that calcium mediates an interaction between negatively charged lipid (e.g., PS) and casein, thereby changing the surface properties of cochleates such that aggregation is inhibited. Another preferred aggregation inhibitor is milk and other milk products such as Half and Half, cream etc. Preferred milk products also contain casein. Another preferred aggregation inhibitor is methylcellulose. In addition, more than one aggregation inhibitor may be employed in the cochleates of the invention. For example, both casein and methylcellulose may be used as an aggregation inhibitor.
In one embodiment, the cochleates of the invention include an aggregation inhibitor to lipid ratio of between about 0.1:1 to about 4:1 by weight. Preferably, the aggregation inhibitor to lipid ratio is about 1:1. A person of ordinary skill in the art will readily be able to determine the amount of aggregation inhibitor needed to form cochleates of the desired size with no more than routine experimentation.
Additional Cargo Moieties
The cochleates and cochleate compositions of the present invention can further include one or more additional cargo moieties. An “additional cargo moiety” is an encochleated moiety in addition to the siRNA or morpholino of the invention, and generally does not refer to the lipid and ion employed to precipitate the cochleate. Cargo moieties include any compounds having a property of biological interest, e.g., ones that have a role in the life processes of a living organism. A cargo moiety may be organic or inorganic, a monomer or a polymer, endogenous to a host organism or not, naturally occurring or synthesized in vitro and the like.
The cargo moiety can be a protonized cargo moiety. The term “protonized cargo moiety” refers to a protonizable cargo moiety that has been protonized. “Protonizable” refers to the ability to gain one or more protons. The protonizable cargo moiety can be weakly basic, and can be protonized by acidification or addition of a proton. Additionally or alternatively, the protonizable cargo moiety can be neutral or weakly acidic and can be protonized in the same manner. Thus, the protonzable cargo moiety can be an anionic or a neutral cargo moiety, which is rendered cationic by protonization, or the protonizable cargo moiety can be cationic, and be rendered more cationic upon protonization. The cargo moiety can also be provided protonized. Optionally, the protonized state can be induced, e.g., by acidification or other methods, as described herein. Acidification renders the cargo moiety cationic or increases the valency of a cargo moiety that is already cationic, e.g., from monovalent to divalent or trivalent.
Examplarary additional cargo moieties include vitamins, minerals, nutrients, micronutrients, amino acids, toxins, microbicides, microbistats, co-factors, enzymes, polypeptides, polypeptide aggregates, polynucleotides, lipids, carbohydrates, nucleotides, starches, pigments, fatty acids, monounsaturated fatty acids, polyunsaturated fatty acids, flavorings, essential oils, extracts, hormones, cytokines, viruses, organelles, steroids and other multi-ring structures, saccharides, metals, metabolic poisons, imaging agents, antigens, porphyrins, tetrapyrrolic pigments, marker compounds, medicaments, drugs and the like.
The cargo moiety can be a diagnostic agent, such as an imaging agent. Imaging agents include nuclear agents and fluorescent probes, e.g., porphyrins. Porphyrins include tetrapyrrolic agents or pigments. One such tetrapyrrolic agent is Zinc Tetra-Phenyl Porphyrin (ZnTPP), which is a hydrophobic, fluorescent molecule that has high absorption in the visible spectrum (dark purple).
The cargo moiety can be a polynucleotide that is expressed to yield a biologically active polypeptide or polynucleotide. Thus, the polypeptide may serve as an immunogen or, e.g., have enzymatic activity. The polynucleotide may have catalytic activity, for example, be a ribosome, or may serve as an inhibitor of transcription or translation, e.g., a small interfering RNA (siRNA) or an antisense molecule. The polynucleotide can be modified, e.g., it can be synthesized to have a morpholino backbone. If expressed, the polynucleotide preferably includes the necessary regulatory elements, such as a promoter, as known in the art. A specific example of a polypeptide is insulin.
The drug can be an organic molecule that is hydrophobic in aqueous media. The drug can also be a water-soluble monovalent or polyvalent cationic molecule, anionic, or net neutral at physiological pH. The drug can be, but is not limited to, a protein, a small peptide, a bioactive polynucleotide, an antibiotic, an antiviral, an anesthetic, an antidepressant, an antipsychotic, an anti-infectious, an antifungal, an anticancer, an immunosuppressant, an immunostimulant, a steroidal anti-inflammatory, a non-steroidal anti-inflammatory, an antioxidant, an antidepressant which can be synthetically or naturally derived, a substance which supports or enhances mental function or inhibits mental deterioration, an anticonvulsant, an HIV protease inhibitor, a non-nucleophilic reverse transcriptase inhibitor, a cytokine, a tranquilizer, mucolytic agent, a dilator, a vasoconstrictor, a decongestant, a leukotriene inhibitor, an anti-cholinergic, an anti-histamine a cholesterol, a lipid metabolism modulating, or a vasodilatory agent.
Examples of additional cargo moieties include Amphotericin B, acyclovir, adriamycin, carbamazepine, ivermectin, melphalen, nifedipine, indomethacin, curcumin, aspirin, ibuprofen, naproxen, acetaminophen, rofecoxib, diclofenac, ketoprofin, meloxicam, nabumetone, estrogens, testosterones, steroids, phenytoin, ergotamines, cannabinoids, rapamycin, propanadid, propofol, alphadione, echinomycin, miconazole nitrate, teniposide, hexamethylmelamine, taxol, taxotere, 18-hydroxydeoxycorticosterone, prednisolone, dexamethazone, cortisone, hydrocortisone, piroxicam, diazepam, verapamil, vancomycin, tobramycin, teicoplanin, bleomycin, peptidolglycan, ristocetin, sialoglycoproteins, orienticin, avaporcin, helevecardin, galacardin, actinoidin, gentamycin, netilmicin, amikacin, kanamycin A, kanamycin B, neomycin, paromomycin, neamine, streptomycin, dihydrostreptomycin, apramycin, ribostamycin, spectinomycin, caspofungin, echinocandin B, aculeacin A, micafungin, anidulafungin, cilofungin, pneumocandin, geldanamycin, nystatin, rifampin, tyrphostin, a glucan synthesis inhibitor, vitamin A acid, mesalamine, risedronate, nitrofurantoin, dantrolene, etidronate, nicotine, amitriptyline, clomipramine, citalopram, dothepin, doxepin, fluoxetine, imipramine, lofepramine, mirtazapine, nortriptyline, paroxetine, reboxitine, sertraline, trazodone, venlafaxine, dopamine, St. John's wort, phosphatidylserine, phosphatidic acid, amastatin, antipain, bestatin, benzamidine, chymostatin, 3,4-dichloroisocoumarin, elastatinal, leupeptin, pepstatin, 1,10-phenanthroline, phosphoramidon, ethosuximide, ethotoin, felbamate, fosphenytoin, lamotrigine, levitiracetam, mephenytoin, methsuximide, oxcarbazepine, phenobarbital, phensuximide, primidone, topirimate, trimethadione, zonisamide, saquinavir, ritonavir, indinavir, nelfinavir, and amprenavir.
Additional drugs include, but are not limited to agents that reduce the risk of atherosclerotic events and/or complications thereof. Such agents include, but are not limited to beta blockers, beta blockers and thiazide diuretic combinations, HMG CoA reductase inhibitors, statins, aspirin, ace inhibitors, ace receptor inhibitors (ARBs), and the like. Suitable beta blockers include, but are not limited to cardioselective (selective beta 1 blockers), e.g., acebutolol (e.g., Sectral™), atenolol (e.g., Tenormin™), betaxolol (e.g., Kerlone™), bisoprolol (e.g., Zebeta™), metoprolol (e.g., Lopressor™), and the like. Suitable non-selective blockers (block beta 1 and beta 2 equally) include, but are not limited to carteolol (e.g., Cartrol™), nadolol (e.g., Corgard™), penbutolol (e.g., Levatol™), pindolol (e.g., Visken™), propranolol (e.g., Inderal™), timolol (e.g., Blockadren™), labetalol (e.g., Normodyne™, Trandate™), and the like.
Suitable beta blocker thiazide diuretic combinations include, but are not limited to Lopressor HCT, ZIAC, Tenoretic, Corzide, Timolide, Inderal LA 40/25, Inderide, Normozide, and the like. Suitable statins include, but are not limited to pravastatin (e.g., Pravachol), simvastatin (e.g., Zocor™), lovastatin (e.g., Mevacor™), and the like. Suitable ace inhibitors include, but are not limited to captopril (e.g., Capoten™), benazepril (e.g., Lotensin™), enalapril (e.g., Vasotec™), fosinopril (e.g., Monopril™), lisinopril (e.g., Prinivil™ or Zestril™), quinapril (e.g., Accupril™), ramipril (e.g., Altace™), imidapril, perindopril erbumine (e.g., Aceon™), trandolapril (e.g., Mavik™), and the like. Suitable ARBS (Ace Receptor Blockers) include but are not limited to losartan (e.g., Cozaar™), irbesartan (e.g., Avapro™), candesartan (e.g., Atacand™), valsartan (e.g., Diovan™), and the like.
Suitable HMG CoA reductase inhibitors that are useful in accordance with the methods and compositions of the invention are statin molecules. These include: Lovastatin (e.g., Mevacor™), Pravastatin (e.g., Pravachol™), Simvastatin (e.g., Zocor™), Fluvastatin (e.g., Lescol™), Atorvastatin (e.g., Lipitor™), or Cerivastatin (e.g., Baycol™).
Other agents that may be administered in conjuction with the cochleates of the invention for treatment of atherosclerotic events and/or complications thereof are phytosterols, phytostanols and their derivatives and isomers; soy protein; soluble fibers, e.g. beta-glucan from, for example, oat and psyllium, nuts, rice bran oil, each of which is particularly suitable for use in food, dietary supplements and food additive compositions. Phytosterols may be solid (e.g., powder, granules) or liquid (e.g., oil) form.
It will be obvious to a person of skill in the art that the choice of the agent for treatment of atherosclerotic events and/or complications thereof depends on the intended delivery vehicle (e.g., food, supplement, pharmaceutical) and the mode of administration.
The cargo moiety can be a polypeptide such as cyclosporin, Angiotensin I, II and III, enkephalins and their analogs, ACTH, anti-inflammatory peptides I, II, III, bradykinin, calcitonin, b-endorphin, dinorphin, leucokinin, leutinizing hormone releasing hormone (LHRH), insulin, neurokinins, somatostatin, substance P, thyroid releasing hormone (TRH) and vasopressin.
The cargo moiety can be an antigen, but is not limited to a protein antigen. The antigen can also be a carbohydrate or DNA. Examples of antigenic proteins include membrane proteins, envelope glycoproteins from viruses, animal cell proteins, other viral proteins, plant cell proteins, bacterial proteins, and parasitic proteins.
Suitable nutrients include, but are not limited to lycopene, micronutrients such as phytochemicals or zoochemicals, vitamins, minerals, fatty acids, amino acids, fish oils, fish oil extracts, biotin, choline, inositol, ginko, and saccharides, herbal products or essential oils. Specific examples include Vitamins A, B, B1, B2, B3, B12, B6, B-complex, C, D, E, and K, vitamin precursors, caroteniods, and beta-carotene, resveratrol, lutein, zeaxanthine, quercetin, silibinin, perillyl alcohol, genistein, sulfurophane, and essential fatty acids, including eicosapentanoic acid (EPA), gamma-3, omega-3, gamma-6, and omega-6 fatty acids, herbs, spices, and iron. Minerals include, but are not limited to boron, chromium, colloidal minerals, colloidal silver, copper, manganese, potassium, selenium, vanadium, vanadyl sulfate, calcium, magnesium, barium, iron and zinc.
The cargo moiety can be a saccharide or sweetener, e.g., saccharine, isomalt, maltodextrine, aspartame, glucose, maltose, dextrose, fructose and sucrose. Flavor agents include oils, essential oils, or extracts, including but not limited to oils and extracts of cinnamon, vanilla, almond, peppermint, spearmint, chamomile, geranium, ginger, grapefruit, hyssop, jasmine, lavender, lemon, lemongrass, marjoram, lime, nutmeg, orange, rosemary, sage, rose, thyme, anise, basil, and black pepper, tea or tea extracts, an herb, a citrus, a spice or a seed.
As used herein, the term “fragile nutrients” refers to fragile compounds (e.g., susceptible to degradation by oxygen, water and the like) derived from plant sources (phytochemicals), animal sources (zoochemicals), or synthetic sources that are either known or are suspected of contributing to the health of an animal.
As used herein, “micronutrient” is a nutrient that the body must obtain from outside sources. Generally micronutrients are essential to the body in small amounts.
In one embodiment, the cargo moiety is added to the composition in a lipid to cargo moiety ratio from between about 20,000:1 to about 1:1. Preferably the cargo moiety is loaded in a lipid to cargo moiety ratio from about 10:1 to about 1:1. More preferably, the cargo moiety is loaded in a lipid to cargo moiety ratio of about 5:1. In another embodiment, a second cargo moiety is additionally incorporated into the cochleate structure in a lipid to cargo moiety ratio of between about 20,000:1 to about 1:1. Preferably the second cargo moiety is loaded in a lipid to cargo moiety ratio from about 10:1 to about 1:1. More preferably, the second cargo moiety is loaded in a lipid to cargo moiety ratio of about 5:1.
Methods of Manufacture
In another aspect, the present invention generally is directed to methods of making cochleates that include siRNA and/or morpholinos. The methods generally can include precipitating a liposome suspension in the presence of an siRNA component and/or a morpholino component, e.g., by adding a multivalent cation. The cochleates can further include additional cargo moieties or other constituents, e.g., aggregation inhibitors. All of the methods described herein can be employed for making both morpholino-cochleates and siRNA cochleates.
Liposomes may be prepared by any known method of preparing liposomes. Thus, the liposomes may be prepared for example by solvent injection, lipid hydration, reverse evaporation, freeze drying by repeated freezing and thawing. The liposomes may be multilamellar or unilamellar, including small unilamellar vesicles (SUV). The liposomes may be large unilamellar vesicles (LUV), stable plurilamellar vesicles (SPLV) or oligolamellar vesicles (OLV) prepared, e.g., by detergent removal using dialysis, column chromatography, bio beads SM-2, by reverse phase evaporation (REV), or by formation of intermediate size unilamellar vesicles by high pressure extrusion. Methods in Biochemical Analysis, 33:337 (1988). Liposomes made by all these and other methods known in the art can be used in practicing this invention.
In a preferred embodiment at least majority of the liposomes are unilamellar. The method can further include the step of filtering a liposomal suspension and/or mechanically extruding the suspension through a small aperture that includes both MLV and ULV liposomes, such that a majority of the liposomes are ULV. In preferred embodiments, at least 70%, 80%, 90% or 95% of the liposomes are ULV.
The method is not limited by the method of forming cochleates. Any known method can be used to form cochleates from the liposomes of the invention (i.e., the liposomes associated with the cargo moiety). In one embodiment, known methods can be employed to form the cochleates of the invention, including but not limited to those described in U.S. Pat. Nos. 5,994,318 and 6,153,217, the entire disclosures of which are incorporated herein by this reference.
In one embodiment, prior to precipitation, SUVs are obtained by, e.g., filtration, and the liposomes are precipated in the presence of siRNA, morpholinos and/or other cargo moiety to form cochleates.
In another embodiment, MLVs are extruded one or more times in the presence of siRNA, morpholinos and/or other cargo moiety, then the liposomes are precipated form cochleates. In this embodiment, it is believed that the MLVs open and reseal during the extrusion process thereby entrapping or otherwise increasing the association of the siRNA, morpholinos and/or other cargo moieties with the MLVs.
In yet another embodiment, a chelating agent (e.g., EDTA) is employed to convert cochleates to liposomes in the presence of the siRNA or morpholino and/or other cargo moiety, and then cation is added to form the cochleates.
In yet another embodiment, enhanced binding of the siRNA or morpholino and the liposome and/or cochleates is achieved by first forming a complex between the siRNA or morpholino and a transfection agent. Such a cationic transfection agent is preferably a polycation, e.g., polyethylenimine (PEI), polyvinylamine, spermine, spermidine, histamine, cationic lipid, or other moiety to enhance binding to the liposome prior to precipitation. Alternatively the polycation is mixed with and binds to the liposome first and then the RNA or morpholino is added. The high transfection potential of DNA complexed with the cationic polymer polyethylenimine (PEI) has been described. Boussif et al. Proc Natl Acad Sci USA 92: 7297-7301(1995). However, increased transfection rates have been coupled with increased toxicity. Bogden et al., AACS PharmSci 4(2) (2002). PEI can be obtained, e.g., from BASF, such as that sold under the tradename Lupasol G35. Cationic polymers may be employed having a variety of molecular weights, and may be branched or unbranched.
It has been discovered, and illustrated the Examples provided herein, that encochleated siRNA-PEI complexes improve transfection into cells without the associated toxicity observed in the literature and in the Examples. In preferred embodiments the cation is a cationic polymer, e.g., PEI or PEI derivatives. Such complexes can be associated with the liposomes by any of the methods discussed herein.
The ratios of lipid to siRNA, and PEI to siRNA, etc. may vary. In a preferred embodiment, N to P ratios (N, nitrogen in PEI to P, phosphate in RNA) may vary from between about 0.5 to about 20. Most preferably between about 4 to about 8.
Additionally or alternatively, siRNA or morpholinos can be encochleated with high or low amounts of calcium. Accordingly, in one embodiment, a high or “elevated” amount of calcium is used, e.g., wherein the calcium concentration in the solution when the cochleates are formed is between about 100 and about 500 mMolar. As used herein, the term “elevated amount of calcium” means a calcium concentration between about 100 and about 500 mMolar. In another embodiment, a relatively low (“depressed”) amount of calcium is used, e.g., between about 1 to about 10 mM. As used herein, the term “depressed amount of calcium” means a calcium concentration between about 1 and about 10 mM. As demonstrated in the examples, siRNA encochleated with high amounts of calcium were more active than siRNA encochleated with low amounts of calcium.
In one embodiment, the pH of the morpoholino or siRNA is adjusted in order to induce a charge in the molecule and thereby increase its interaction with the cochleate, and in particular the phospholipid. In one embodiment, the method includes adjusting the pH of the liposomal suspension. In another embodiment, the method may include charging the base pairs of the siRNA or morpholino. For example, the pH can be adjusted to about 8.5 or about 6.0 to 6.5 or about 3.0 to 3.5 for a morpholino. Raising the pH of a liposomal suspension in the presence of morpholino causes the morpholino to associate or complex with the liposomes. Raising or lowering the pH of the siRNA or morpholino (between 3 to 11) can affect charge on the bases or backbone and enhance association with the lipid.
It has been discovered that adjusting the pH and/or charging the base pairs can improve association of the morpholino or siRNA with the cochleate. Accordingly, the method can further include the step of adjusting the pH of the morpholino or siRNA prior to or during the the contact with the liposome or formation of the precipitate. Any known method of adjusting pH can be employed. For example, a morpholino or siRNA can be acidified with acidic aqueous buffer. Alternately, pH can be raised with a basic aqueous buffer. Acidic and basic buffers are known in the art, and identification of a variety of buffers would require no more than routine experimentation by one of ordinary skill in the art. Alternatively, the pH of the morpholino or siRNA can be adjusted by slow addition of an acid, e.g., hydrochloric acid, or a base, e.g., sodium hydroxide.
In yet other embodiments, the pH of the morpholinos or siRNA can be adjusted prior to incorporation into the lipid precipitates. In other embodiments, the pH of the resultant morpholino cochleates in solution can be adjusted using, e.g., acid or base.
In one embodiment, cochleates may be formed by dissolving a lipid component and siRNA, morpholino and/or other cargo moiety in an organic solvent (e.g., THF) to form a solution, forming cargo moiety liposomes, and precipitating the liposome to form a cargo moiety-cochleate. The solvent can optionally be removed prior to the formation of liposomes and/or after the liposomes are formed.
In another embodiment, cochleates can be formed by introducing the molecule (e.g, siRNA, morpholino and/or additional cargo moiety), to a liposome in the presence of a solvent such that the molecule associate with the liposome, and precipitating the liposome to form a cochleate. The molecule can be introduced by introducing a solution of the solvent and the molecule to the liposome by, e.g., dropwise addition, continuous flow or as a bolus. The molecule can also be introduced to the liposome prior to or after the solvent.
The liposome may be prepared by any known method of preparing liposomes. Additionally, the method is not limited by the method of forming cochleates. Any known method can be used to form cochleates from the liposomes of the invention (i.e., the liposomes associated with the cargo moiety). In a preferred embodiment, the cochleate is formed by precipitation. Additionally or alternatively, an aggregation inhibitor can be added to the solvent at the liposomal stage, or to the precipitated cochleate.
Any suitable solvent can be employed in connection with the present invention. Solvents suitable for a given application can be readily identified by a person of skill in the art. Suitable solvents include but are not limited to dimethylsulfoxide (DMSO), a methylpyrrolidone, N-methylpyrrolidone (NMP), acetonitrile, alcohols, e.g., butanol and ethanol (EtOH), dimethylformamide (DMF), tetrahydrofuran (THF), and combinations thereof.
Moreover, the order of addition of various components (e.g., siRNA, lipid, calium, cation complexing agents, solvent) can readily be varied as exemplified in the Examples provided in the instant application. Concentrations and ratios of various components can also be modified as exemplified herein. Finally, ionic conditions may be adjusted as appropriate. Salt concentrations may be approximately isotonic (150 mM), to high (e.g., 1 to 2 molar), to hypotonic, to zero (water).
An exemplary method of forming morpholino-cochleates in accordance with the present invention can generally include the following steps. Liposomes and morpholino oligonucleotides can be solubilized and vortexed to form a morpholino-liposome suspension. Typically, about 2 minutes of vortexing is sufficient to form a suitable suspension, which can be varied and confirmed by visual inspection, e.g., through a microscope.
Next, the pH of the suspension is either raised to about 8.5 (e.g., with 1 N NaOH) or lowered to about 6.5 (e.g., with 1 N HCl). Since the morpholinos are non-charged, this step is done to place a charge on the base pairs of the morpholino, to favor an interaction with the liposomes. This ionic interaction can be achieved by either increasing the pH to 8.5 or by lowering the pH to 6.5. At this point the morpholinos interact with the lipid. The suspension is again vortexed to induce interaction between the morpholinos and the liposomes. Typically, about 10 minutes of vortexing is suitable. Interaction between the morpholinos and the liposomes can be confirmed by phase and defraction microscopy. The morpholinos associate with or incorporate into the liposomal bilayer. The morpholino-liposomes are then filtered (e.g., using a 0.22 micrometer syringe filter).
Calcium solution is added to the suspension with vortexing. A suitable addition technique is to use an eppendorf repeater pipetter with a 500 microliter tip, and to add 10 microliter aliquiots to the tube every 10 seconds until cochleates are formed. Cochleate formation can be confirmed, e.g., by observing the preparation under a microscope and by a measurement of pH. The cochleates can then be stably stored at 4° C. in a nitrogen atmosphere.
Methods of Use
In another aspect, the invention provides methods of administering siRNA or morpholinos to a host (e.g. a cell or organism). The method generally includes administering a biologically effective amount of a siRNA-cochleate or morpholino-cochleate composition to a host. The cochleate compositions can include any of the compositions described herein including, e.g., compositions with additional cargo moieties and/or aggregation inhibitors.
The host can be a cell, a cell culture, an organ, a tissue, and organism, an animal etc. For example, in one embodiment, the siRNA or morpholino is delivered to a cell in the host (e.g., to a cytosol compartment of the cell).
In one embodiment the siRNA mediates RNAi against a target mRNA in the host. In another embodiments, the morpholino mediates translation of a target mRNA in the host. In either embodiment, although acting by a different mechanism, specific target protein synthesis preferably is reduced in the host. In preferred embodiments, target protein synthesis is reduced by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100%.
Physical methods of introducing siRNAs and morpholinos to cells and organisms employing cochleates include contacting the cells with the cochleates or administering the cochleates to the organism by any means, e.g., orally, intramuscularly, intradermally, transdermally, intranasally, intrarectally, subcutaneously, topically, or intravenously.
siRNA-cochleates and morpholino-cochleates may be directly introduced to or into a cell (i.e., intracellularly), or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing a cell or organism in a solution containing the cochleates. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are sites where the cochleate compositions of the present invention may be introduced.
One mechanism by which the siRNA, morpholinos and/or other cargo moieties may be introduced to a cell is via a fusion event between the cochleate and the cell. Many naturally occurring membrane fusion events involve the interaction of calcium with negatively charged phospholipids (e.g., PS and phosphatidylglycerol). Calcium-induced perturbations of membranes containing negatively charged lipids, and the subsequent membrane fusion events, are important mechanisms in many natural membrane fusion processes. Therefore, cochleates can be envisioned as membrane fusion intermediates. As the calcium rich, highly ordered membrane of a cochleate first comes into close approximation to a natural membrane, a perturbation and reordering of the cell membrane is induced, resulting in a fusion event between the outer layer of the cochleate and the cell membrane. This fusion results in the delivery of a small amount of the material associated with the cochleate into the cytoplasm of the target cell. The cochleate can then break free of the cell and be available for another fusion event, either with the same or another cell.
Additionally or alternatively, particularly with active phagocytic cells, cochleates may be taken up by endocytosis and fuse from within the endocytic vesicle. Cochleates made with trace amounts of fluorescent lipids have been shown to bind and gradually transfer lipids to the plasma membrane and interior membranes of white blood cells in vitro. Accordingly, the encochleated siRNA, morpholinos and/or additional cargo moieties of the invention can be introduced to a cell in a host by endocytosis. Alternatively they may be introduced by pinocytosis.
A cell or tissue with a target mRNA may be derived from or contained in any organism. The organism may be a plant, animal, protozoan, bacterium, virus, or fungus. The plant may be a monocot, dicot or gymnosperm; the animal may be a vertebrate or invertebrate. Preferred microbes are those used in agriculture or by industry, and those that are pathogenic for plants or animals. Fungi include organisms in both the mold and yeast morphologies. Plants include arabidopsis; field crops (e.g., alfalfa, barley, bean, corn, cotton, flax, pea, rape, nice, rye, safflower, sorghum, soybean, sunflower, tobacco, and wheat); vegetable crops (e.g., asparagus, beet, broccoli, cabbage, carrot, cauliflower, celery, cucumber, eggplant, lettuce, onion, pepper, potato, pumpkin, radish, spinach, squash, taro, tomato, and zucchini); fruit and nut crops (e.g., almond, apple, apricot, banana, black-berry, blueberry, cacao, cherry, coconut, cranberry, date, filbert, grape, grapefruit, guava, kiwi, lemon, lime, mango, melon, nectarine, orange, papaya, passion fruit, peach, peanut, pear, pineapple, pistachio, plum, raspberry, strawberry, tangerine, walnut, and watermelon); and ornamentals (e.g., alder, ash, aspen, azalea, birch, boxwood, camellia, carnation, chrysanthemum, elm, fir, ivy, jasmine, juniper, oak, palm, poplar, pine, redwood, rhododendron, rose, and rubber). Examples of vertebrate animals include fish, mammal, cattle, goat, pig, sheep, rodent, hamster, mouse, rat, primate, and human; invertebrate animals include nematodes, other worms, drosophila, and other insects.
The cell having the target mRNA may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like. The cell may be a stem cell or a differentiated cell. Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, ostcoblasts, osteoclasts, hepatocytes, and cells of the endocrine or exocrine glands.
Depending on the particular target mRNA and the dose of siRNA and/or morpholino material delivered, this process may provide partial or complete loss of function for the target mRNA in a host. A reduction or loss of mRNA expression in at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more of the host or targeted cells in the host is exemplary Inhibition of mRNA expression refers to the absence (or observable decrease) in the level of protein and/or mRNA product from a target mRNA. Specificity refers to the ability to inhibit the target mRNA without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism (as presented below in the examples) or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS).
A simple assay that can be employed for assessing siRNA delivery and activity in a variety of compositions follows, many variations on which can readily be ascertained by the skilled practitioner. anti-GFP siRNA and non-specific siRNA can be obtained from commercial sources, e.g., Ambion, Inc (Austin, Tex.). Anti-GFP siRNA and non-specific siRNA compositios, e.g., various cochleate compositions described herein or known in the art can be manufactured. Cells, such as SKOV cells can be transfected with green fluorescent protein (GFP) expressing plasmid, followed by treatment with anti-GFP siRNA and non-specific siRNA compositions and any other suitable controlls. GFP fluorescence can then be measured after a predetermined time period, e.g., 48 or 72 hours. This data can then be compared to determine which compositions were more effective at delivery of active siRNA than others.
For RNA-mediated inhibition in a cell line or whole organism, mRNA expression is conveniently assayed by use of a reporter or drug resistance mRNA whose protein product is easily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin. Depending on the assay, quantitation of the amount of mRNA expression allows one to determine a degree of inhibition which is greater than 10%, 33%, 50%, 90%, 95% or 99% as compared to a cell not treated according to the present invention. Lower doses of injected material and longer times after administration of encochleated siRNA and/or morpholinos may result in inhibition in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of targeted cells). Quantitation of mRNA expression in a cell may show similar amounts of inhibition at the level of accumulation of target mRNA or translation of target protein.
As an example, the efficiency of inhibition may be determined by assessing the amount of mRNA product in the cell; mRNA may be detected with a hybridization probe having a nucleotide sequence outside the region used for the inhibitory double-stranded RNA, or translated polypeptide may be detected with an antibody raised against the polypeptide sequence of that region.
The RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of material may yield more effective inhibition; lower doses may also be useful for specific applications.
The cochleates can be coadministered with a further agent. The second agent can be delivered in the same cochleate preparation, in a separate cochleate preparation mixed with the cochleates preparation of the invention, separately in another form (e.g., capsules or pills), or in a carrier with the cochleate preparation. The cochleates can further include one or more additional cargo moieties, such as other drugs, peptides, nucleotides (e.g., DNA and RNA), antigens, nutrients, flavors and/or proteins. Such molecules have been described in U.S. Pat. No. 6,153,217 (Jin et al.) and U.S. Pat. No. 5,994,318 (Gould-Fogerite et al.), and International Patent Publication Nos. WO 00/42989 (Zarif et al.) and WO 01/52817 (Zarif et al.). These patents are expressly incorporated by this reference.
The cochleates of the invention also can include a reporter molecule for use in in vitro diagnostic assays, which can be a fluorophore, radiolabel or imaging agent. The cochleates can include molecules that direct binding of the cochleate to a specific cellular target, or promotes selective entry into a particular cell type.
Another advantage of the present invention is the ability to modulate cochleate size. Modulation of the size of cochleates can change the manner in which the siRNA, morpholino and/or additional cargo moiety is taken up by cells. For example, in general, small cochleates are taken up quickly and efficiently into cells, whereas larger cochleates are taken up more slowly, but tend to retain efficacy for a longer period of time. Also, in some cases small cochleates are more effective than large cochleates in certain cells, while in other cells large cochleates are more effective than small cochleates.
Methods of Treatment
In another aspect, the present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant or unwanted target gene expression or activity. The method generally includes administering to a subject a therapeutically effective amount of a morpholino-cochleate composition or siRNA-cochleate of the invention such that the disease or disorder is treated.
The present invention provides a method for treating a subject that would benefit from administration of a composition of the present invention. Any therapeutic indication that would benefit from the cochleate compositions of the present invention can be treated by the methods of the invention. The method includes the step of administering to the subject a composition of the invention, such that the disease or disorder is treated.
With regard to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. “Pharmacogenomics,” as used herein, refers to the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market. More specifically, the term refers the study of how a patient's genes determine his or her response to a drug (e.g., a patient's “drug response phenotype,” or “drug response genotype”). Thus, another aspect of the invention provides methods for tailoring an individual's prophylactic or therapeutic treatment with either the target gene molecules of the present invention or target gene modulators according to that individual's drug response genotype. Pharmacogenomics allows a clinician or physician to target prophylactic or therapeutic treatments to patients who will most benefit from the treatment and to avoid treatment of patients who will experience toxic drug-related side effects.
The language “therapeutically effective amount” is that amount necessary or sufficient to produce a desired physiologic response. The effective amount may vary depending on such factors as the size and weight of the subject, or the particular compound. The effective amount may be determined through consideration of the toxicity and therapeutic efficacy of the compounds by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it may be expressed as the ratio LD50/ED50. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to unaffected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any composition used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 (i.e., the concentration of the test composition that achieves a half-maximal response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
1. Prophylactic Methods
In one aspect, the invention provides a method for preventing in a subject, a disease or condition associated with an aberrant or unwanted target gene expression or activity, by administering to the subject a therapeutic agent (e.g., morpholinos, siRNAs or vector or transgene encoding same). Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the target gene aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression. Depending on the type of target gene aberrancy, for example, a target gene, target gene agonist or target gene antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein.
2. Therapeutic Methods
Another aspect of the invention pertains to methods of modulating target gene expression, protein expression or activity for therapeutic purposes. Accordingly, in an exemplary embodiment, the modulatory method of the invention involves administering to a host a composition of the invention that is specific for the target gene or protein (e.g., is specific for the mRNA encoded by said gene or specifying the amino acid sequence of said protein) such that expression or one or more of the activities of target protein is modulated. These modulatory methods can be performed in vivo (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by administering the agent to a subject). As such, the present invention provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant or unwanted expression or activity of a target mRNA polypeptide or nucleic acid molecule Inhibition of target mRNA activity is desirable in situations in which the target mRNA is abnormally unregulated and/or in which decreased target mRNA activity is likely to have a beneficial effect.
One advantage of the cochleates of the present invention is the safety and stability of the composition. Cochleates can be administered orally or by instillation without concern, as well as by the more traditional routes, such as oral, intranasal, intraoculate, intraanal, intravaginal, intrapulmonary, topical, subcutaneous, intradermal, intramuscular, intravenous, subcutaneous, transdermal, systemic, intrathecal (into CSF), and the like. Direct application to mucosal surfaces is an attractive delivery means made possible with cochleates.
The disease or disorder treated in accordance with the present invention can be any disease or disorder that can be treated by the successful administration of siRNAs or morpholinos of the invention. Exemplary diseases and disorders include neurological disorders associated with aberrant or unwanted gene expression such as schizophrenia, obsessive compulsive disorder (OCD), depression and bipolar disorder, Alzheimer's disease, Parkinson's disease, lymphoma, immune-mediated inflammatory disorders, hyperplasia, cancers, cell proliferative disorders, blood coagulation disorders, Dysfibrinogenaemia and hemophelia (A and B), dematological disorders, hyperlipidemia, hyperglycemia, hypercholesterolemia, obesity, acute and chronic leukemias and lymphomas, sarcomas, adenomas, fungal infections, bacterial infections, viral infections, a lysosomal storage disease, Fabry's disease, Gaucher's Disease, Type I Gaucher's Disease, Farber's disease, Niemann-Pick disease (types A and B), globoid cell leukodystrophy (Krabbe's disease), metachromic leukodystrophy, multiple sulfatase deficiency, sulfatidase activator (sap-B) deficiency, sap-C deficiency, GM1-gangliosidosis, Tay-Sachs disease, Tay-Sachs B1 variant, Tay-Sachs AB variant, Acid Maltase Deficiency, Mucopolysaccharidosis, Sandhoff's disease, a cancer, an autoimmune disorder, systemic lupus erythematosis, multiple sclerosis, myasthenia gravis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, Grave's disease, allogenic transplant rejection, rheumatoid arthritis, ankylosing spondylitis, psoriasis, scleroderma, carcinomas, epithelial cancers, small cell lung cancer, non-small cell lung cancer, prostate cancer, breast cancer, pancreatic cancer, hepatocellular carcinoma, renal cell carcinoma, biliary cancer, colorectal cancer, ovarian cancer, uterine cancer, melanoma, cervical cancer, testicular cancer, esophageal cancer, gastric cancer, mesothelioma, glioma, glioblastoma, pituitary adenomas, inflammatory diseases, osteoarthritis, atherosclerosis, inflammatory bowel diseases (Crohns and ulcerative colitis), uveitis, eczema, chronic rhinosinusitis, asthma, a hereditary disease, cystic fibrosis, and muscular dystrophy.
The method can also be used for regulating gene expression to promote greater health or quality of life, e.g., to limit cholesterol uptake or regulate lipid metabolism, weight gain, hunger, aging, or growth. Cosmetic effects such as wrinkle reduction, hair growth, pigmentation, or dermatologic disorders may also be treated.
The compositions of the present invention can be used to enhance antiviral defense, transposon silencing, gene regulation, centromeric silencing, and genomic rearrangements. The compositions of the invention can also be used to inhibit expression of other types of RNA, e.g., ribosomal RNA, transfer RNA, and small nuclear RNA.
The siRNA and morpholino cochleate compositions of the present invention can be utilized in any number of gene therapies. One such treatment is for the management of opportunistic fungal infections like Aspergillus fumigatus, particularly in immunocompromised patients. Current treatment protocols with existing antifungal agents can still result in mortality rates of 80% in HIV patients or those undergoing cancer-related chemotherapies. However, the targeted disruption of the P-type H+-ATPase, an important plasma membrane enzyme critical to fungal cell physiology, may be an alternate and more effective way to destroy fungi such as A. fumigatus. This particular ATPase was cloned and selective small interfering RNA (siRNA) oligonucleotides obtained, which can knockdown the expression of this critical protein, resulting in the death of the fungus. siRNA-cochleates having siRNA targeted to the H+-ATPase of A. fumigatus will be delivered using cochleate compositions as described herein.
The essential role of the H+-ATPase in spore germination and multiplication of growing cells provides an opportunity to explore the ability of nanocochleates to efficiently deliver siRNAs targeted to the H+-ATPase of A. fumigatus. Given the medical importance of A. fumigatus and the paucity of available antifungal compounds, siRNA cochleate compositions have the potential to be effective therapeutic alternatives.
Treatment of Fungal Infections
Opportunistic fungal infections are widespread in cancer, HIV infected and other immunosuppressed individuals, and are a growing concern for the management of such patients. These organisms have become important causes of morbidity and mortality in the immunocompromised (Jarvis, W. R., (1995) Clin Infect Dis. 20(6): 1526-30; Dupont Jarvis, B., et al., (1994) J Med Vet Mycol 32(Suppl 1): 65-77; Bodey, G. P. (1988) J Hosp Infect 11 Suppl A:411-26), and make opportunistic fungal infections a major source of nosocomial disease. Pfaller, M. A. (1995) Clin Infect Dis. 20(6):1525; Pfaller, M. A., et al., (1999) Diagn Microbiol Infect Dis, 33(4): p. 217-22; Pfaller, M. A., et al., (1998) Diagn Microbiol Infect Dis 31(1): 289-96; Pfaller, M. A., et al., (1998) Diagn Microbiol Infect Dis 30(2):121-9; Pfaller, M. A., et al., (1998) J Clin Microbiol, 36(7): 1886-9. The mold Aspergillus fumigatus causes a variety of diseases including allergic bronchopulmonary aspergillosis in asthma patients and invasive pulmonary aspergillosis (IPA) in immunocompromised patients. Denning, D. W. (1998) Clin Infect Dis 26(4): 781-803; quiz 804-5; Andriole, V. T. (1993) Clin Infect Dis. 17 Suppl 2: S481-6; Latge, J. P. (1999) Clin Microbiol Rev. 12(2): 310-50. Invasive aspergillosis is a common infection in patients who are immunocompromised, particularly in oncology patients, patients receiving other immunosuppressive therapy, bone marrow transplant patients, and HIV-infected patients. Aspergillus fumigatus accounts for 30% of fungal infections among cancer patients and 10 to 25% in leukemia patients (Denning, D. W. (1998) Clin Infect Dis 26(4): 781-803; quiz 804-5). Early diagnosis of invasive fungal infections is critical for successful therapeutic outcome, although such determinations are difficult to achieve. Denning, D. W. (1996) Curr Clin Top Infect Dis. 16: 277-99; Andriole, V. T., (1996) Infect Agents Dis. 5(1): 47-54; Latge, J. P., (1995) Curr Top Med Mycol. 6: 245-81. The spectrum of disease manifestations is determined by a combination of genetic predisposition, host immune system defects, and virulence of the Aspergillus species. Amphotericin B is the standard of treatment for severe Aspergillus infections (Stevens, D. A. et al., (2000) Clin Infect Dis. 30(4): 696-709.), although mortality in these patients remains high. Latge, J. P., (1999) Microbiol Rev. 12(2): 310-50. In addition, amphotericin B may cause toxicity resulting in severe side effects, including permanent renal insufficiency. Newer compositions, like liposomal suspensions, can reduce toxicity but do not eliminate it. Stevens, D. A. et al., (2000) Clin Infect Dis. 30(4): 696-709; Groll, A. H., et al., (1998) Klin Padiatr, 210(4): 264-73; Leenders, A. C., et al., (1998) Br J Haematol, 103(1): 205-12; Ng, T. T. et al. (1995) Arch Intern Med. 155(10): 1093-8; Robinson, R. F. et al. (1999) J Clin Pharm Ther. 24(4): 249-57. As the incidence of topical and invasive mycoses increases, there is a continuing need to develop more effective therapeutics to deal with opportunistic fungal infections and to better understand the pathogenicity of these organisms.
Plasma Membrane Proton Pump (H+-ATPase)
The plasma membrane of all fungi contains an essential proton pumping ATPase (H+-ATPase) that regulates intracellular pH (Morsomme, P. et al. (2000) Biochim Biophys Acta. 1469(3): 133-57; Serrano, R., (1998) Biochim Biophys. Acta. 947: 1-28), and maintains the electrochemical proton gradient across the plasma membrane, which is necessary for nutrient uptake, including certain essential amino acids, sugars and ions. Serrano, R., (1998) Biochim Biophys. Acta. 947: 1-28. The plasma membrane H+-ATPase has been extensively studied at the biochemical, biophysical and genetic levels (Morsomme, P. et al. (2000) Biochim Biophys Acta. 1469(3): 133-57; Perlin, D. S., et al. (1992) Acta Physiol Scand Suppl. 607: 183-92; Moller, J. V. et al. (1996) Biochim Biophys. Acta. 1286: 1-51.) in model organisms such as Saccharomyces cerevisiae. It consists of a single Mr˜100 kDa polypeptide that is a predominant membrane constituent representing 5-30% of the total membrane protein. Monk, B. C., et al., (1991) J Bacteriol. 173(21): 6826-36. It utilizes energy from ATP hydrolysis to actively pump protons from inside the cell to the outside. The H+-ATPase is a typical Class IIIa P-type ion translocating ATPase that includes the Na+,K+-ATPase of animal cell plasma membranes, Ca2+-ATPases of sarcoplasmic reticulum and red blood cells.
The consensus view of the topology and secondary-structure model for H+-ATPase and other type II P-type ATPases enzyme it that they are organized into three distinct structure-function domains. Zhang, P. et al. (1998) Nature. 392: 835-839. The cytoplasmic domain contains the sites for ATP binding and phosphorylation. The membrane embedded transport region contains ten α-helical transmembrane segments. Transmembrane segments M4, M5 and M6 contain aspartate and glumatate residues important for cation binding and ion translocation. Lutsenko, S. et al. (1995) Biochemistry. 34(48): 15607-13.; MacLennan, D. H et al. (1997) J Biol Chem. 272(46): 28815-8.
The gene encoding the fungal H+-ATPase, PMA1, shows extensive amino acid sequence similarity between the various fungal enzymes (51-98%), but less than 30% similarity with its animal cell counterparts. Wach, A., A. et al. (1992) J. Bioenerg. Biomembr., 24: 309-317. The catalytic ATP hydrolysis domain displays the highest level of conservation, although signature sequences are found outside this region as well. Lutsenko, S. et al. (1995) Biochemistry. 34(48): 15607-13. The N and C-termini of the P-type ATPases are highly divergent, as are extracellular loop domains linking transmembrane segments, which contribute regulatory features of each class of ATPase. The divergence of structure on the extracellular face of the bilayer occurs among P-type ATPases with different ion specificities but also in isoforms. It accounts for the differential response of the animal cell Na+,K+-ATPase to cardiac glycosides (Lingrel, J. B. et al. (1994) J. Biol. Chem. 269: 19659-19662) and for the specificity of antiulcer drugs like omeprazole to the gastric H+,K+-ATPase. Sachs, G., et al. (1995) Annu. Rev. Pharmacol. Toxicol., 35: 277-305. It is this well documented ability to develop drug specificity between P-type ATPase molecules that has contributed to the success of this enzyme family as therapeutic targets, and could facilitate the development of highly specific antifungal drugs.
The plasma membrane H+-ATPase plays a critical role in fungal cell physiology and it is one of the few antifungal targets that have been demonstrated to be essential by gene disruption. Serrano, R. et al. (1986) Nature, 1986. 319: 689-693. The fungal H+-ATPase has attributes that are attractive as a drug discovery target. It is an essential enzyme that is needed for both new growth and stable cell maintenance in the absence of growth. Due to its slow turnover in the membrane (˜11 h), it is likely that inhibitors of the H+-ATPase will be fungicidal. Preliminary studies with Ebselen, a model compound that inhibits ATP hydrolysis illustrates its fungicidal properties in Cryptococcus neoformans. Soteropoulos, P., et al. (2000) Antimicrob Agents Chemother. 44(9): 2349-55. Several recent reports demonstrate HtATPase-mediated antifungal properties from novel reagents including CAN-296, a complex carbohydrate (Ben-Josef, A. M., et al. (2000) Int J Antimicrob Agents. 13(4): 287-95) and NC1175, (3-[3-(4-chlorophenyl)-2-propenoyl]-4-[2-(4-chlorophenyl)vinylene]-1-ethyl-4-piperidinol hydrochloride) a thiol-blocking conjugated styryl ketone that also exhibits antifungal activity against a wide spectrum of pathogenic fungi. Manavathu, E. K., et al. (1999) Antimicrob Agents Chemother, 43(12): 2950-9.
The essential role of the P type, H+-ATPase in fungal cell physiology makes this enzyme a good target model for the efficacy of cochleate nanotechnology to deliver the cochleates of the present invention. Given the medical importance of Aspergillus fumigatus infection in immunocompromised individuals, and the paucity of available antifungal compounds, siRNA cochleates have the potential to be an effective therapeutic alternative.
Combination Therapies
The above methods can be employed in the absence of other treatment, or in combination with other treatments. Such treatments can be started prior to, concurrent with, or after the administration of the compositions of the instant invention. Accordingly, the methods of the invention can further include the step of administering a second treatment, such as a second treatment for the disease or disorder or to ameliorate side effects of other treatments. Such second treatment can include, e.g., any treatment directed toward reducing an immune response. Additionally or alternatively, further treatment can include administration of drugs to further treat the disease or to treat a side effect of the disease or other treatments (e.g., anti-nausea drugs).
In one aspect, the invention provides a method for preventing in a subject, a disease or disorder which can be treated with administration of the compositions of the invention. Subjects at risk for a disease or condition which can be treated with the agents mentioned herein can be identified by, for example, any or a combination of diagnostic or prognostic assays known to those skilled in the art. Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented or, alternatively, delayed in its progression.
Pharmaceutical Compositions
The invention pertains to uses of the cochleates of the invention for prophylactic and therapeutic treatments as described infra. Accordingly, the cochleates of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the cochleates of the invention and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art.
Cochleates of the present invention readily can be prepared from safe, simple, well-defined, naturally occurring substances, e.g., phosphatidylserine (PS) and calcium. Phosphatidylserine is a natural component of all biological membranes, and is most concentrated in the brain. The phospholipids used can be produced synthetically, or prepared from natural sources. Soy PS is inexpensive, available in large quantities and suitable for use in humans. Additionally, clinical studies indicate that PS is safe and may play a role in the support of mental functions in the aging brain. Unlike many cationic lipids, cochleates (which are composed of anionic lipids) are non-inflammatory and biodegradable. The tolerance in vivo of mice to multiple administrations of cochleates by various routes, including intravenous, intraperitoneal, intranasal and oral, has been evaluated. Multiple administrations of high doses of cochleate compositions to the same animal show no toxicity, and do not result in either the development of an immune response to the cochleate matrix, or any side effects relating to the cochleate vehicle.
The cochleates of the present invention can be administered to animals, including both human and non-human animals. It can be administered to animals, e.g., in animal feed or water.
Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants may also be present in the compositions.
Examples of pharmaceutically acceptable antioxidants, which may also be present in compositions of therapeutic compounds of the invention, include water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
Compositions of the present invention include those suitable for oral, nasal, topical, transdermal, buccal, sublingual, rectal, vaginal or parenteral administration. The compositions may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which may be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of 100%, this amount will range from about 1% to about 99% of active ingredient, preferably from about 5% to about 70%, most preferably from about 10% to about 30%.
Methods of preparing these compositions or compositions include the step of bringing into association a composition of the present invention with the carrier and, optionally, one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association a composition of the present invention with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
Compositions of the invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) or as mouth washes and the like, each containing a predetermined amount of a composition of the present invention as an active ingredient. A composition of the present invention may also be administered as a bolus, electuary, or paste.
In solid dosage forms of the invention for oral administration (capsules, tablets, pills, dragees, powders, granules, and the like), the cochleates of the present invention are mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, or any of the following: fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, or silicic acid; binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose or acacia; humectants, such as glycerol; disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; solution retarding agents, such as paraffin; absorption accelerators, such as quaternary ammonium compounds; wetting agents, such as, for example, cetyl alcohol and glycerol monostearate; absorbents, such as kaolin and bentonite clay; lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and coloring agents.
In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered composition moistened with an inert liquid diluent.
The tablets, and other solid dosage forms of the pharmaceutical compositions of the present invention, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes or microspheres.
They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which may be dissolved in sterile water, or some other sterile injectable medium immediately before use.
These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which may be used include polymeric substances and waxes. The active ingredient may also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
Liquid dosage forms for oral administration of the compounds of the invention include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert dilutents, the oral compositions may also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
Compositions of the pharmaceutical compositions of the invention for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more compounds of the invention with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound. Compositions of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray compositions containing such carriers as are known in the art to be appropriate.
Dosage forms for the topical or transdermal administration of a composition of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The composition may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
The ointments, pastes, creams and gels may contain, in addition to a composition of this invention, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
Powders and sprays may contain, in addition to a composition of this invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays may additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
Transdermal patches have the added advantage of providing controlled delivery of a composition of the present invention to the body. Such dosage forms may be made by dissolving or dispersing the composition in the proper medium. Absorption enhancers may also be used to increase the flux of the composition across the skin. The rate of such flux may be controlled by either providing a rate controlling membrane or dispersing the composition in a polymer matrix or gel.
Ophthalmic compositions, eye ointments, powders, solutions and the like, are also within the scope of this invention.
Pharmaceutical compositions of this invention suitable for parenteral administration comprise a cochleate of the invention in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the composition isotonic with the blood of the intended recipient or suspending or thickening agents.
Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity may be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the siRNA then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, and sodium chloride, in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating a composition of the invention in the desired amount in an appropriate solvent with one or a combination of ingredients enumerated above, as necessary, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the composition into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the cochleate compositions of the invention plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Injectable depot forms are made by forming microencapsule matrices of the subject compounds in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release may be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable compositions are also prepared by entrapping the cochleates in liposomes or microemulsions which are compatible with body tissue.
Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the composition can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the composition in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the composition. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
The compositions of the invention also can be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
In one embodiment, the compositions of the invention are prepared with carriers that will protect the composition against rapid elimination from the body, such as a controlled release composition, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such compositions will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of a composition calculated to produce the desired therapeutic effect in association with the pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the composition and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such a composition for the treatment of individuals.
The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration. The pharmaceutical compositions can be included in a container along with one or more additional compounds or compositions and instructions for use. For example, the invention also provides for packaged pharmaceutical products containing two agents, each of which exerts a therapeutic effect when administered to a subject in need thereof. A pharmaceutical composition may also comprise a third agent, or even more agents yet, wherein the third (and fourth, etc.) agent can be another agent against the disorder, such as a cancer treatment (e.g., an anticancer drug and/or chemotherapy) or an HIV cocktail. In some cases, the individual agents may be packaged in separate containers for sale or delivery to the consumer. The agents of the invention may be supplied in a solution with an appropriate solvent or in a solvent-free form (e.g., lyophilized). Additional components may include acids, bases, buffering agents, inorganic salts, solvents, antioxidants, preservatives, or metal chelators. The additional kit components are present as pure compositions, or as aqueous or organic solutions that incorporate one or more additional kit components. Any or all of the kit components optionally further comprise buffers.
The present invention also includes packaged pharmaceutical products containing a first agent in combination with (e.g., intermixed with) a second agent. The invention also includes a pharmaceutical product comprising a first agent packaged with instructions for using the first agent in the presence of a second agent or instructions for use of the first agent in a method of the invention. The invention also includes a pharmaceutical product comprising a second or additional agents packaged with instructions for using the second or additional agents in the presence of a first agent or instructions for use of the second or additional agents in a method of the invention. Alternatively, the packaged pharmaceutical product may contain at least one of the agents and the product may be promoted for use with a second agent
EXEMPLIFICATION
The use of antisense oligonucleotides as therapeutic agents has been widely investigated in the past few years. Brantl, S. (2002) Biochim Biophys Acta.1575 (1-3):15-25; Brent, L. J. N, et al. (2002) Neurosci. 114(2):275-278; Akhtar et al. (1991) Nucleic Acids Res. 19: 5551. Their efficacy is based on their ability to recognize their mRNA target in the cytoplasm and to block gene expression by binding and inactivating selected RNA sequences. While the potential of antisense is widely recognized, limitations such as poor specificity, instability, unpredictable targeting and undesirable non-antisense effects hamper therapeutic use of antisense molecules. In addition, one of the major limiting aspects of this gene regulatory strategy is poor cell penetration. Akhtar et al. (1991) Nucleic Acids Res. 19, 5551.
Intracellular delivery and concentration is necessary for antisense inhibition of gene expression. It is believed that naked oligonucleotides enter the cell via active processes of adsorptive endocytosis and pinocytosis. However, naked antisense oligonucleotides do not appear to penetrate the endosomal barrier and gain access to the cytoplasmic compartment to any great extent. Lebedeva, I. et al. (2001) Annu. Rev. Pharmacol. Toxicol. 4:403-419; Weiss, B. et al. (1997) Neurochem. Int. 31:321-348). Although complexes of antisense oligonucleotides with cationic liposomes have enhanced intracellular delivery, they also have significant cytotoxicity. Their utility in vitro and in vivo has also been limited by their lack of stability in serum and their inflammatory properties.
Compositions of the present invention utilize cochleates to achieve enhanced delivery of morpholino antisense molecules in vitro. The morpholine backbone of these antisense molecules is not recognized by nucleases, and is therefore more stable. Morpholinos function by an RNase H-independent mechanism and are soluble in aqueous solutions, with most being freely soluble at mM concentrations (typically 10 mg/ml to over 100 mg/ml). Nasevicius, A. et al. (2000) Nat. Genet. 26:216-220; Lewis, K. E. et al. (2001) Development 128:3485-3495; Mang'era, K. O. et al. (2001) Eur. J. Nucl. Med. 28:1682-1689; Satou, Y. et al. (2001) Genesis. 30:103-106; Tawk, M. et al. (2002) Genesis. 32:27-31. They are highly effective with predictable targeting. Nasevicius, A. et al. (2000) Nat. Genet 26:216-220; Lewis, K. E. et al. (2001) Development. 128:3485-3495; Mang'era, K. O. et al. (2001) Eur. J. Nucl. Med. 28:1682-1689; Satou, Y. et al. (2001) Genesis. 30:103-106; Tawk, M. et al. (2002) Genesis. 32:27-31.
Example 1
Preparation of Morpholino Cochleates
Rhodamine-labeled phosphatidyl ethanolamine (Rho-PE) liposomes were prepared by adding dioleoylphosphatidylserine (DOPS) and Rho-PE at a ratio of 20:1 (Rho-PE:DOPS) to chloroform at a ratio of 10 mg lipid/ml in a 50 ml sterile tube. The concentration of Rho-PE was approximately 0.1% or 0.01% with respect to the DOPS.
The sample was blown down under nitrogen to form a film. Once dry, the sample was resuspended with TES buffer at a ratio of 10 mg lipid/ml. The liposomes were then passed through a 0.22 μm filter. The homogenous population of rhodamine-labeled liposomes were stored at 4° C. in the absence of light under nitrogen.
Morpholinos were obtained from GeneTools, LLC (Philomath, Oreg.) for the GAPDH antisense sequence 5′ATCCGTTGACACCGACCTTCACCAT3′ (SEQ ID NO.: 1), and GAPDH mismatch sequence 5′ATCCCTTGAGACCGAGCTTCTCCAT3′ (SEQ ID NO.: 2). These sequences have been used previously to target the first 25 bases of the coding sequence and block GAPDH. They were solubilized by adding 0.834 ml TES [N-tris (hydroxymethyl)methyl-2-aminoethanesulfonic acid] buffer to the original bottle at neutral pH. The morpholino stock was stored in 100 μl aliquots at −20° C. Prior to use, the aliquot must be heated at 65° C. for 5 min to ensure the morpholino hasn't dropped out of solution.
Approximately 400 μl of the fluorescent Rho-PE liposome suspension and about 100 μl of the morpholino solution were added to a sterile glass tube and vortexed thoroughly (approximately 2 minutes). The samples were checked for pH and observed both macro- and microscopically. The samples were observed to include liposomes and morpholino oligomers. The pH of the sample was slowly increased to approximately 8.0-8.5, by addition of 1N NaOH. The sample was then vortexed for about 10 minutes. The suspension was then sonicated for about 2 minutes in a nitrogen gas atmosphere, and filtered using a 0.22 μm syringe filter. Morpholinos are hydrophilic non-charged molecules, and therefore do not interact strongly with the liposomes. Raising the pH places a charge on the base pairs of the morpholino, favoring an interaction with the liposomes.
Cochleates were then formed by the slow addition (10 μl) of 0.1 M calcium chloride to the suspension of Rho-PE liposomes and morpholino oligomers at a molar ratio of lipid to calcium of 2:1 with an external excess of 6 mM calcium. The calcium chloride was added while vortexing using an eppendorf repeater pipette with a 500 microliter tip, adding 10 μl aliquots to the suspension every 10 seconds. At this point, the sample was observed to include morpholino-cochleates. The sample was then stored at 4° C. in the absence of light.
Samples were also prepared by lowering the pH to approximately 6.0-6.5 as described above. As the pH was decreased from 7.4 to approximately 6.0, an interaction was observed between the lipid and the morpholino, similar to that observed at pH 8.5.
Example 2
Delivery of Morpholinos Via Cochleates Into Cells
Morpholino-cochleates were prepared as described in Example 1, with FITC-labeled GAPDH morpholinos. These morpholino-cochleates were administered to NGF differentiated rat P12 cells and photographed at 3 hours and 12 hours as shown in FIGS. 1A and 1B, respectively, after cochleate introduction. As illuminated by the fluoresced rhodamine using LCSM fluorescence imaging, the cochleates fuse with the outer membrane and form submembrane aggregates. FIGS. 1C (low power) and 1D (high power) are photographs of flouresced rhodamine labeled cochleates containing fluorescein isothiocyanate (FITC) labeled morpholinos. FIGS. 1C and 1D depict cochleates containing morpholinos, morpholinos that have been released into the cytosol from unwrapped cochleates, and the delivery of FITC labeled anti-GAPDH Morpholino into the cytoplasm. The morpholinos delivered into the cells depicted in these FIGS. 1A-D were retained in the cells for at least 72 hours. The labeled morpholinos were delivered into the cell cytosol and nucleus (FIGS. 1C and 1D).
As shown in FIGS. 4A-B, the cochleates fuse or are taken up by the cells and form submembrane aggregates. FIG. 4A shows intracellular rhodamine cochleates (punctuate and diffuse red color) after 3 hours. Yellow, yellow-green and orange-red indicate cochleates containing morpholinos. FIG. 4B shows delivery 12 hours after cochleate introduction. Rhodamine labeled lipid, originally in cochleates, is largely distributed to the cellular membranes although there appears to be accumulation within the cell, suggesting that some empty cochleates may be sequestered in vacuoles, while FITC-labeled morpholinos (green color) have been released into the cytosol from unwrapped cochleates by 12 hr. after initial presentation to the cell.
As shown in FIG. 3, Western blotting for GAPDH protein in these labeled cells showed a time dependent decrease in GAPDH protein levels by 18-24 hours following treatment with cochleates with GAPDH antisense morpholino (lower blot) while control cells receiving vehicle with cochleate alone (upper blot) showed no change in GAPDH protein levels. This example demonstrates that morpholino-cochleates are an efficient technique for delivering antisense morpholinos in a manner that does not compromise the integrity of the cells. Plain cochleates or cochleates with sense morpholino at the same concentration had no toxicity.
Example 3
Delivery of Morpholinos Via Cochleates Into Retinal Ganglion Cells
Morpholino-cochleates were prepared as described in Example 1 with FITC-labeled GAPDH morpholinos. These morpholino-cochleates were administered to retinal ganglion cells in situ in retinal organotype culture. It was observed that the morpholino-cochleates readily interacted with the cells in the retinal ganglion cell layer (FIGS. 2A and 2B). FIGS. 2A and 2B are images of X-Y RGCL LCSM computational slices demonstrating avid cochleate uptake by retinal ganglion cells in situ. Scale bars indicate 10 micrometers.
FIG. 2A indicates cochleate delivery and biological activity of the antisense molecules. Interference with GAPDH by the antisense molecule triggers apoptosis, detected here by YOYO staining of all the retinal ganglion cells in the field. Cell nuclei with apoptotic chromatin condensation have very bright homogeneous YOYO signals (See FIG. 2B). This system provides a very efficient technique for delivering antisense oligonucleotides in a manner that does not compromise the integrity of the cells. In sharp contrast, other delivery methods were associated with some cytotoxity and a maximum of 10% transfection.
Example 4
Cochleate Delivery of Antisense DNA in a Murine Model of Chronic Lymphocytic Leukemia
NZB mice develop a B-1 cell lymphoproliferative disorder that serves as a murine model of chronic lymphocytic leukemia (CLL). These malignant B-1 cells produce significantly higher levels of IL-10 mRNA than normal B-1 or B cells. The addition of antisense oligodeoxynucleotides specific for IL-10 mRNA dramatically inhibits the growth of leukemic B-1 cells in a time and dose dependent manner. Control cell lines that do not depend on IL-10 for growth are not affected. In vitro antisense therapy targeted at the 5′ region of the IL-10 mRNA not only resulted in inhibition of malignant B-1 cell proliferation, but also inhibited IL-10 production by malignant B-1 cells. In vivo, antisense therapy was effective in preventing death of the animals due to uncontrolled growth of 5×106 intraperitoneally transferred malignant B-1 cells. In these experiments, after approximately 6 weeks, at which time the control animals had all died, the antisense IL-10 treated groups had no evidence of disease.
Comparison of Cochleates and Mini-Osmotic Pump
Cochleates were much more effective in delivering antisense IL-10 oligonucleotide for preventing the growth of malignant B-1 cells in vivo, and protecting against disease and death. Using a mini-osmotic infusion pump, 300 ug/day phosphorothioate-modified antisense IL-10 oligonucleotide was constantly infused for 28 days, totaling 8.4 mg. Lower quantities or shorter times did not result in protection from tumor cell challenge.
Although phosphorothioate oligos are known to have much longer half lives in vivo, much lower doses of unmodified phosphodiester antisense IL-10 oligonucleotides were effective when formulated and delivered in cochleates. Four injections (days 0, 5, 8, and 14) of antisense IL-10 cochleates, totaling 1.3 mg, prevented the growth of malignant B-1 cells. The reasons for this increased efficacy of unmodified antisense IL-10 when delivered in cochleates may be due to the prevention of nuclease degradation in plasma and interstitial fluid, delivery of the intact oligonucleotide directly into the cytoplasm of the target cell, and/or slow delivery over a prolonged period of time, due to the multilayered nature of the cochleates.
Cochleate Delivery of Antisense DNA Protects Against B Cell Lymphoma
FIG. 5 summarizes in vivo antisense IL-10 experiments including both forms of delivery, pumps and cochleates. All mice were (NZB DBA/2) F1 recipients that received a transfer of leukemic B-1 cells. The percent of diseased animals in a particular treatment group is the number of diseased animals divided by the animals studied, multiplied by 100. Disease includes all mice that died before day 60 with hind leg paralysis or evidence of clones of malignant B-1 cells detected by flow cytometry or abnormal pathology at the time of sacrifice. Mini infusion pump antisense IL-10 treated animals (0/4), Antisense IL-10-Cochleate treated animals (0/3), sense IL-10 (4/5), control (receiving either pumps and buffer alone or cochleates alone) (7/7), untreated receiving no treatment following transfer of the malignant B-1 cells (7/7).
This example demonstrates successful cochleate delivery of an antisense molecule in vivo, wherein biological activity was retained.
Example 5
Delivery of Morpholino-Cochleates to Rats with Induced Parkinson's Disease-Like Pathology
Parkinson's disease-like pathology with be induced in rats with CSF-delivered rotenone and joint rotenone-CUL cerebrospinal fluid (CSF) delivery. Morpholino-cochleates will be used to deliver morpholinos to suppress GAPDH and p53 protein levels to study its effect on NSdn apoptosis and protein aggregation caused by the CSF infusion.
Based on studies in cultured cells and the findings of Greenamyre et al., it is expected that chronic CSF-delivered rotenone will induce PD-like pathology in the rats at lower dosages than those found for rats with intravenous delivery and that joint rotenone-CUL CSF delivery will markedly shift the concentration dependence to lower values. Based on previous studies in culture, it is expected that both the p53 and GAPDH antisense will reduce NSdn apoptosis and may also decrease any protein aggregation caused by the CSF infusion. The GAPDH antisense treatment should not affect p53 levels or subcellular localization while the p53 antisense treatment should prevent both GAPDH upregulation and nuclear accumulation.
Morpholino-cochleates will be employed to induce non-lethal reductions in GAPDH (see FIG. 3 in which GAPDH was reduced to about 50%), and p53 proteins. High GAPDH morpholino-cochleate concentrations resulting in marked GAPDH reductions cause cellular death over 3 to 8 hours, probably due to a failure of glycolysis. The morpholino oligos from Example 1 from GeneTools, LLC (Philomath, Oreg.) will be used. For p53 antisense and mismatch, 5′TCATATCCGACTGTGAATCCTCCAT3′ (SEQ ID NO.: 3) and 5′TCATTTCCGTCTGTGTATCCTGCAT3′ (SEQ ID NO.: 4), respectively, will be used. These sequences have been used to block GAPDH and p53 synthesis (Chen et al. (1999) J Neurosci. 19:9654-62; Fukuhara et al. (2001) Neuroreport 12:2049-52), and target the first 25 bases of each coding sequence. Three other series of sequences will be used that have previously altered either p53 or GAPDH synthesis.
Since both the cochleates and the morpholinos can be fluorescently labeled as described above and are retained in cells after paraformaldehyde fixation, it should be possible to observe the proportion of cells that concentrate the carrier and the morpholino before collecting lysates from ventral mesencephalon to measure the overall reduction in GAPDH or p53 protein. Furthermore, fluorescence labeling should allow a determination of whether specific SNc cellular phenotypes showing evidence of apoptosis or protein aggregation also took up the cochleates.
Similar to preliminary studies with retrograde tracers (Yee et al., (1994) Cell Mol Neurobiol 14:475-86; Shimizu et al. (2001) J Cereb Blood Flow Metab 21:233-43), the antisense and mismatch oligonucleotides will be infused into the lateral ventricle using a cannulae system. Morpholinos will be carried into NSdns and other cells from the CSF by the cochleates. Zarif et al. (2000) Adv Exp Med Biol 465:83-93. Rhodamine can be included in the lipid constituents of the cochleates and will allow the visualization of the binding of the cochleate to the outer membranes of the cell using LCSM fluorescence imaging as illustrated in FIGS. 1A-D.
Both the oligomeric specific and oligomeric non-specific antibodies will be employed to determine whether all or part of the immunoreaction in a specific subcellular locus is due to a specific oligomer of GAPDH. Monoclonal antibody that specifically recognizes GAPDH monomer or dimer but not GAPDH tetramer will be obtained from Ono Pharmaceuticals (Japan). Also used will be a sheep polyclonal antibody that only recognizes GAPDH tetramer and a mouse monoclonal antibody that recognizes all oligomeric forms of GAPDH. Carlile et al. (2000) Mol. Pharmacol. 57:2-12. Co-staining with YOYO-1 will be used to differentiate the nuclear and non-nuclear compartments. Carlile et al. (2000) Mol. Pharmacol. 57:2-12.
In order to quantitate immunofluorescence for different antibodies and different treatments, sections will be incubated for different treatments together to ensure identical exposure to antibodies. Fluorescence intensity will be measured from within 3 extra nuclear 4 μm×4 μm regions within the somata of randomly chosen neurons using the program Northern Eclipse (Empix Imaging, Mississauga, Ontario). Three measurements will be made immediately outside each neuronal somata in order to determine intraneuronal fluorescence above background. Tsuda et al. (1994) Neuron 13:727-36. Approximately 600 neurons will be examined for each animal and 7200 for each concentration time. The program allows the coordinates of each measurement to be retained so that measurements can be made for identical loci from simultaneously collected images for different antibodies.
It is expected that both p53 tumor suppressor protein and GAPDH will undergo increases and nuclear accumulation in response to rotenone or CLβL exposure. Rotenone will only increase the proteins in NSdns while CLβL will increase them in all SNc cells. It is expected that a proportion of the neurons will show dense nuclear immunofluorescence for the antibody against GAPDH monomer/dimer and for the antibody against all GAPDH oligomeric forms, but not for the antibody that only recognizes tetramer. A follow-up study has been conducted on our studies in Parkinson's Disease (PD) postmortem SNc (Tatton, Exp Neurol 166:29-43 (2000)), using the antibody that recognizes all GAPDH oligomers with similar examinations using the monomer/dimer selective antibody. It was found that GAPDH nuclear accumulation in PD postmortem SNc involves only the monomer/dimer. It will be valuable to determine if the model shows the same oligomeric selectivity.
Example 6
siRNA-Cochleates for the Treatment of Fungal Infections
These studies will determine the relative effectiveness of siRNA-cochleaste compositions for preventing invasive Aspergillosis in animal models that mimic disease in humans. Female BalbC or DBA2 mice from Charles River Labs will be used for this study because they behave in a reliable manner when infected with fungal pathogens. Previous studies have shown that intravenous inoculation with pathogenic fungi in mice produces an infection similar to that seen in man.
Aspergillus fumigatus H+-ATPase will be studied as an effect therapeutic target for antifungal agents employing siRNA-cochleates of the invention. The plasma membrane H+-ATPase from Candida albicans was cloned and characterized. Monk, B. C., et al. (1991) J Bacteriol. 173(21): 6826-36. Similar cloning and characterization projects have been completed on plasma membrane H+-ATPases from Cryptococcus neoformans (Soteropoulos, P., et al. (2000) Antimicrob Agents Chemother 44(9): 2349-55) and Aspergillus fumigatus (Burghoorn, H. P et al. (2002) Antimicrob Agents Chemother 46(3):615-24).
The gene, AfPMA1, encoding the plasma membrane proton pump (H+-ATPase) of Aspergillus fumigatus was characterized from Aspergillus fumigatus strain NIH 5233 and clinical isolate H11-20. An open reading frame of 3109 nucleotides with two introns near the N-terminus predicts a protein consisting of 989 amino acids with a molecular weight of approximately 108 kDa. The predicted Aspergillus fumigatus enzyme is 89% and 51% identical to H+-ATPases of A. nidulans and S. cerevisiae, respectively. AfPMA1 is a typical member of the class III P-type ATPase family that contains 10 predicted transmembrane segments and conserved sequence motifs, TGESL (SEQ ID NO.: 13), CSDKTG (SEQ ID NO.: 14), MXTGD (SEQ ID NO.: 15) and GDGXNDXP (SEQ ID NO.: 16) within the catalytic region. The enzyme represents 2% of the total plasma membrane protein, and it is characteristically inhibited by orthovanadate with an IC50˜0.8 μM. The H+-ATPase from Aspergillus spp. contains a highly acidic insertion region of 60 amino acids between transmembrane segments 2 and 3 which was confirmed in the membrane assembled-enzyme with a peptide-derived antibody. Increasing gene copy number of AfPMA1 onfers enhanced growth in low pH medium consistent with its role as a proton pump. Burghoorn, H. P. et al. (2002) 46(3):615-24.
Cell Phenotype and Morphology Changes Will be Evaluated for Aspergillus fumigatus
The normal septate hyphae are wide and form dichotomous branching, i.e., a single hypha branches into two even hyphae, and then the mycelium continues branching in this fashion. It was observed that sublethal amount of anti-H+-ATPase antagonists like ebselen produce long thin hyphal elements with diminished branching. As the H+-ATPase activity is diminished, increasing cell surface area helps maintain the overall capacity of the system by increasing the number of pumps. It is expected, that stressing the mutant proton pumps by acidifying the cytoplasm with weak acids at low external medium pH will show similar results. Aspergillus is particularly resistant to high temperature and grows efficiently at 45° C. It was observed that the MIC for cell killing with ebselen is decreased with increasing temperature. Whether inhibition of PMA1 alters the temperature profile for growth will be determined. Finally, spore formation and spore germination will be examined in a similar manner.
The essential role of the H+-ATPase in spore germination and multiplication of growing cells provides an opportunity to explore the ability of nanocochleates to efficiently deliver siRNAs targeted to the H+-ATPase of A. fumigatus. Given the medical importance of A. fumigatus and the paucity of available antifungal compounds, siRNA cochleate compositions have the potential to be effective therapeutic alternatives.
The goal is to determine the feasibility and technical merit of preparing and testing stabilized siRNA-cochleate compositions that will enhance the antifungal activity of these oligonucleotides.
Stable compositions of nanocochleates containing siRNA targeting Aspergillus fumigatus H+-ATPase are to be prepared, and that these compositions will be capable of interacting with and inhibiting the growth of Aspergillus fumigatus both in vitro and in vivo.
Standard protocols will be used to prepare siRNA-cochleates. Lipid (PS) to siRNA ratios will range from 25:1 to 100:1, wt:wt. Purified siRNA molecules will be purchased from commercial vendors.
To stabilize the particle size of the cochleate compositions, several commercially available, FDA approved excipients will be evaluated for their ability to stabilize size characteristics of the cochleate compositions. Excipient candidates will be chosen that have the potential to interact with the cochleate surface and prevent cochleate-cochleate interaction. E.g., excipients that contain hydrophilic polymers (e.g., polyethyleneglycol (PEG)) with/or without a hydrophobic tail can be used. Excipients with properties that mimic casein, which is a highly phosphorylated, calcium-binding molecule also will be tested.
Aspergillus fumigatus PMA1 siRNA
To investigate gene silencing by RNA interference as a potential therapeutic in pathogenic fungi, small interference RNA (siRNA) were designed to the PMA1 gene of Aspergillus fumigatus. PMA1 encodes the essential plasma membrane proton-ATPase, which regulates electrochemical proton gradients and intracellular pH in this pathogenic organism. Miller, M. D. et al. (1992) J Exp Med 176:1739-1744. Two PMA1 sense and antisense siRNA pairs (21 mers) were designed to regions 100 and 162 nucleotides downstream of the start codon (Genbank/NCBI accession number AY040609) using Qiagen's siRNA design tool (python.penguindreams.net/Xeragon_Order_Entry/jsp/SearchByAccessionNumber.jsp). The siRNA sequences are listed in Table I. Burghoorn, H. P. et al. (2002) Antimicrob Agents Chemother 46:615-24.
TABLE I
A. fumigatus PMA1 siRNA sequences
cDNA Target
Antisense siRNA
Sequence
Region
Sense siRNA (5′-3′)
(3′-5′)
AACCGTTACATC
100 nt downstream
CCGUUACAUCUC
dTdTGGCAAUGUA
TCGACTGCT
from start codon
GACUGCUdTdT
GAGCUGACGA
(SEQ ID NO.: 5)
(SEQ ID NO.: 6)
(SEQ ID NO.: 7)
AAGCCTCCAGCA
162 nt downstream
GCCUCCAGCAGA
dTdTCGGAGGUCG
GAAGAAGAA
from start codon
AGAAGAAdTdT
UCUUCUUCUU
(SEQ ID NO.: 8)
(SEQ ID NO.: 9)
(SEQ ID NO.: 10)
The characterization of siRNA cochleate compositions will be performed using standard protocols including biochemical analysis (lipid and drug quantitation and integrity), morphology (light and electron microscopy), and particle sizing.
Imaging, General Methods.
An Olympus FV500 confocal laser scanning microscope will be used to obtain images of fluoresce-tagged cochleates in real time from living cells and from fixed tissue in order to investigate the dynamics of cochleate uptake by macrophages and fungus. A Hitachi 54700 field emission scanning electron microscope (FESEM) will be used to investigate details of cochleate ultrastructure and provide ultra-high resolution images of cochleate-cell membrane/wall interactions.
Confocal Imaging
A) Cochleate Uptake Over Time.
Cells/fungi will be exposed to cochleates for 2, 5, 10, 15, 30, 60 min, 12 h, 24 h, 48 h to establish a temporal sequence for uptake and dispersal. Cells/fungi will be fixed with 2% gluteraldehyde (EM grade) and will be exposed to other cell markers for colocalization. For real-time imaging, coverslips are transferred to a environmentally controlled sealed chamber.
B) Subcellular Localization.
Cell nuclei marked with Alexa 488-histone 1 will be used in live cells to determine whether siRNA localizes in the nucleus. Lysotracker probes, which mark lysosomes, will help determine if cochleates and/or their contents are found in lysosomes. Tarasova N. I. et al. (1997) J. Biol. Chem. 272: 14817-14824. A cationic linear polyene, TMA-DPH, a lipid marker for endocyotsis and exocytosis, (Kawasaki Y. et al. (1991) BBBA 1067: 71-80; Illinger D. et al. (1993) Biol. Cell 79: 265-268) will assist in determining how cochleates are absorbed/released by macrophages. All markers are available at Molecular Probes (Oregon)
FESEM Imaging
Rapid freezing of unfixed, bulk biological samples such as cochleates and cells/fungi will produce the least distortion in the specimens. However, it will be necessary to test alternate protocols to see what additional information about cochleate/cell interactions may be obtained.
A) Double Coating of Unfixed, Frozen, Hydrated Samples.
A nitrogen slush will be used to cool down unfixed, hydrated biological samples and then perform a double coating layer (2 nm platinum, followed by 5-10 nM carbon) to allow high resolution backscattered electron detection (Walther P. et al. (1997) Scanning 19:343-348).
B) Cryopreserved Samples.
30% sucrose and 20% sucrose/3% PEG-400 cryopreservation methods will be tested on fixed samples. This method will likely not provide ultra high resolution images as in double-coating, but may be best for preparing composite and topographic EM images at lower accelerating voltages.
C) Fixed Dehydrated, Critical Point Dried Samples.
Method A may be too damaging to fungi, in which case a critical point drying method (Muller, W. H. et al. (2000) 22:295-303) will be used that can also be used for mammalian cells to provide high resolution imaging. This method will provide high resolution images. However, this method can produce more distortion of the sample than A or B.
Example 7
Methods of Making siRNA-Cochleates Directed Against the Expression of erbB Protein
Labelled siRNA (Sense: 5′-UCCCGAGGGCCGGUAUACATT-3′ (SEQ ID NO.: 11); Antisense: 5′-UGUAUACCGGCCCUCGGGATT-3′ (SEQ ID NO.: 12) directed against erbB (targeting codons 852-873 of the mRNA encoding erb) were obtained from PPD, Inc. (Wilmington, N.C.). siRNA were Cy5 labelled or FITC labeled for various experiments as indicated in the below experiments. The annealed 22 bp siRNA 20 micromolar stock solution included 0.26 μg siRNA/μl. The siRNA buffer contained either (i) 100 mM potassium acetate, 30 mM HEPES-KOH (pH7.4), and 2 mM magnesium acetate; or (ii) 20 mM KCl, 6 mM HEPES (pH 7.5), and 0.2 mM magnesium chloride.
Stock liposome suspensions were prepared by solubilizing DOPS powder alone, or DOPS powder (99% by weight) and Rhodamine PE (1% by weight), in chloroform, drying to film under nitrogen, and rehydration in TES buffer (pH 7.4) to a concentration of 10 mg/ml by vortexing.
Cochleates were prepared from liposomes as described above using the following methods. In the following methods, unless otherwise indicated, the DOPS:siRNA weight ratio was 50:1, and methods were carried out at neutral pH conditions with approximately isotonic salt concentrations.
Trapping Method.
6.5 μl of stock liposome suspension was filtered with a 0.2 micron filtration membrane to obtain small unilamellar vesicle liposomes (SUVs). 5 μl of the stock siRNA solution (1.3 μg siRNA) was placed in an Eppendorf micro-centrifuge tube, and the 6.5 μl SUV suspension (65 μg DOPS lipid) was added to the siRNA. 88.5 μl TES Buffer was added and mixed well, followed by addition of 8 μl of 0.1 M calcium chloride and mixed well to form cochleates.
Extrusion Method.
5 μl of the 20 μmM stock siRNA solution (1.3 μg siRNA) was placed in an Eppendorf micro-centrifuge tube. 6.5 μl DOPS liposome suspension (65 μg lipid) from the 10 mg/ml suspension was added to the siRNA. 88.5 μl of TES buffer was added and the mixture extruded 7 times with an Avanti mini-extruder, which allows production of unilamellar lipid vesicles by multiple extrusions between two connected syringes through a polycarbonate membrane with defined pore size. Membrane used was 0.2 microns pore size. 7 μl of 0.04 M calcium chloride was added and mixed well to form cochleates.
Alternative Extrusion Method
25 μl of the 20 μmM stock siRNA solution (6.5 μg siRNA) was placed in an Eppendorf micro-centrifuge tube. 25 μl unfiltered DOPS liposome suspension (250 μg lipid) from the 10 mg/ml suspension was added to the siRNA. The mixture was extruded 7 times. 6 μl of 0.05 M calcium chloride solution was added and mixed well to form cochleates. The lipid:siRNA ratio was 39:1 wt/wt.
Cochleate Conversion Method.
65 μl DOPS liposome suspension from the 10 mg/ml suspension was placed in an Eppendorf micro-centrifuge tube. 4 μl of 0.1 M calcium chloride solution was added and mixed well to form cochleates in suspension. 7 μl of this suspension was added to another micro-centrifuge tube, and centrifuged at 13.00 RPM for 30 minutes. The supernatant was removed, and 5 μl of the 20 μmM stock siRNA solution (1.3 μg siRNA) was added to the cochleates. 3 μl of 150 mM EDTA was added to convert the cochleates to liposomes associated with the the siRNA. 8 μl of 0.01 M calcium chloride solution was added and mixed well, followed by the addition of 80 μl of TES buffer and 2 mM calcium chloride and mixing.
Example 8
siRNA-Cochleates Directed Against the Expression of erbB Protein
Employing the siRNA identified and liposome stock solutions prepared in Example 7, siRNA cochleates were prepared and administered to ovarian cancer cell line SKOV3 (PPD, Inc.). In the following methods, the DOPS:siRNA weight ratio was 2:1 (12.45 μg lipid, 6.5 μg siRNA). The lipid concentration in the liposomes was about 100 μg/ml (0.1 mg/ml), the siRNA concentration approximately 57 μg/ml (0.057 mg/ml). SKOV3 cells were grown in monolayers in humidified air with 5% CO2 at 37° C. in 60 mm2 Petri dishes (Corning) containing 5 mL of DMEM supplemented with 10% FBS. The calcium concentration in mix was 130 mM for the elevated or high calcium method, and 3.8 mM for the low or depressed calcium method.
High Calcium Method.
25 μl of the 20 μM stock siRNA solution was placed in an Eppendorf micro-centrifuge tube to which 6 μl of 2.5 M calcium chloride solution was added and mixed well. 83 μl of DOPS liposomes at 150 μg/ml in TES (pH 7.0) was added, followed by 17 μl of TES Buffer. The total volume (131 μl) was mixed well. 5 μl of the mixture was then added to 45 μl cell culture medium and incubated for 72 hours at 37° C. The culture was fixed and stained with antibodies for erbB2 expression.
Low Calcium Method.
25 μl of the 20 μmM stock siRNA solution was placed in an Eppendorf micro-centrifuge tube to which 5 μl of 0.1 M calcium chloride solution was added and mixed well. 83 μl of DOPS liposomes at 150 μg/ml in TES (pH 7.0) was added, followed by 17 μl of TES Buffer. The total volume (131 μl) was mixed well. 5 μl of the mixture was then added to 45 μl cell culture medium and incubated for 72 hours at 37° C. The culture was fixed and stained with antibodies for erbB2 expression.
Control Preparations.
SKOV3 cells were also incubated with empty cochleates made employing the same methods (except without addition of siRNA) and Lipofectamine formulated siRNA. The cultures were also fixed and stained with with antibodies for erbB2 expression.
Partial Knockdown of erbB2 in SKOV3 Cells
Absorption results (ELISA assay) for surface erb B2 expression for each of the treated cultures are shown in FIG. 6. Decreased absorption indicates inhibition of Erb B2 by specific or non-specific mechanisms. The low calcium siRNA cochleate composition (LCaRNAcc) did not appear to inhibit Erb B2 compared to empty cochleates (LCaEPTcc). Whereas, the high calcium siRNA-cochleate composition did (HCaRNAcc vs. HCaEPTcc). Less staining of wells treated with Lipofectamine formulated siRNA (lipo-RNAamb and lipo-RNA-Cy5) may be due to specific inhibition combined with non-specific down regulation and fewer cells associated with greater cellular cytotoxicity.
FIG. 7 is a series of fluorescent confocal microscopy images of the SKOV3 cells 24 hours post-exposure to: empty cochleates (panel A), 1% rhodamine-labelled cochleates (panel B), anti-erb B2 siRNA-cochleates (panel C), and Cy5 labelled anti-erb B2 siRNA-cochleates (panel D). The cochleates images in panel C and panel D were manufactured using the high calcium method described above. Partial knockdown of cytoplasmic erb B2 by anti erb B2 siRNA-cochleates was observed (panel C and panel D), as well as confirmation of intracellular delivery and localization of cochleates and siRNA around the nucleus (panel B and panel D). Additionally, the subcellular distribution of Rhodamine-labelled cochleates (panel B) and Cy5 siRNA-cochleates (panel D) appears to be different, indicating delivery and release of siRNA.
FIG. 8 is a series of confocal microscopy images of SKOV3 cells 24 hours post-exposure to: empty cochleates (panel A), 1% rhodamine-labelled cochleates (panel B), anti-erb B2 siRNA-cochleates (panel C), and Cy5 labelled anti-erb B2 siRNA-cochleates (panel D). Partial knockdown of membrane-localized erbB2 in SKOV3 cells after exposure to siRNA(erbB2) cochleates was observed (panel C and panel D). Also, intracellular delivery of rhodamine cochleates (panel B) and Cy5 labeled siRNA (panel D) is observed.
Example 9
Cochleates Prepared with siRNA-PEI Complexes
siRNA and polyethylenimine (PEI) were allowed to associate to form a positively charged complex and then bound to negatively charged liposomes and encochleated. The effect of these encochleated complexes was studied.
22.5 μl of siRNA(20 μM) was added to an Eppendorf micro-centrifuge tube. 16.2 μl of PEI (2000 MW, Lupasol G35, BASF) at a concentration of 0.05%, was added and mixed well. Then, 116 μl of pre-made DOPS liposome at 1.5 mg/ml (in TES, pH7.0) was added to this mixture and mixed well. Finally, 115 μl of 0.1 M calcium chloride was added and mixed well to form cochleates. Cochleate morphology was confirmed microscopically. In order remove any free (unencochleated) siRNA from the siRNA-cochleate composition, the siRNA-cochleates were pelleted by centrifugation and the supernatants removed. Pellets were re-suspended.
Cochleates also were formed with non-specific siRNA (no specificity against erbB2 and no known intracellular target) according to the same method. The anti Erb siRNA-cochleates and non-specific siRNA-cochleates (both formed with PEI) were administered to SKOV3 cells at 0.25 μg (full dose) and 0.125 μg (50% dose), alongside untreated SKOV3 cells and were incubated for 72 hours.
As summarized in FIG. 9, SKOV3 cells treated with the siRNA/PEI-cochleate compositions (Erb_siRNA/PEI/Cch.Plt (1)), showed a significant reduction in Erb B staining compared to untreated cells (Cell only (1)). Analogous compositions with a non-specific siRNA showed statistically less inhibition (CtrlErb_siRNA/PEI/Cch.Plt (1)). When half the concentration of siRNA/PEI-cochleates were used, the anti-Erb B siRNA/PEI-cochleates (ErbB Plt(2)) continued to cause a significant reduction in Erb B staining, but the control cochleates (Ctl.Plt(2)) showed no inhibiotion compared to untreated cells (Cell Only (2)). This indicates an anti-ErbB2-specific effect of the cochleate delivered siRNA.
The siRNA/PEI-cochleates were compared to SKOV3 cells treated with (1) unencochleated siRNA/PEI complex, (2) encochleated Fetal Bovine Serum (FBS) and PEI, (3) unencochleated FBS and PEI, and untreated cells. These controls were formulated by the same methods and in the same quantities and concentrations as the siRNA cochleates.
As summarized in FIG. 10, greater inhibition of Erb B was seen upon administration of siRNA/PEI-cochleates (Erb_siRNA/PEI/Cch.Plt(1)), as compared to the unencochleated siRNA/PEI (Erb_siRNA/PEI/Cplz.Plt(1)), indicating a positive role for cochleate delivery of siRNA. FBS/PEI-cochleates (FBS/PEI/Cch.Plt(1)), and unencochleated FBS/PEI (FBS/PEI/CplxPlt(1)), showed a decrease in staining due to cytotoxicity of un-complexed PEI.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
|
13298902
|
biodelivery sciences international, inc.
|
USA
|
B2
|
Utility Patent Grant (with pre-grant publication) issued on or after January 2, 2001.
|
Open
|
536/ 24.5
|
|
Mar 30th, 2022 06:04PM
|
Mar 30th, 2022 06:04PM
|
BioDelivery Sciences
|
|
Pharmaceuticals & Biotechnology
|